Os.16117.1.S1_s_at |
Description |
gb:BX928288 DB_XREF= gi:41883173 DB_XREF=BX928288 CLONE=y659c03p5 TID=Os.16117.1 CNT=4 FEA=EST TIER=ConsEnd STK=0 UG=Os.16117 (NCBI UniGene Cluster) UG_TITLE=Transcribed sequence with weak similarity to protein sp:O15212 (H.sapiens) PFD6_HUMAN Prefoldin subunit 6 REP_ORG=O. sativa | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Associated TIGR Gene Locus |
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Gene Context (flanking 25kb) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Gene Ontology Classification |
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Probe Info |
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Target Sequence | TCCGCGAGATGCAGCGCGACCTCGAGTCCNAGGCCAACGCCCTCAGCAAGATCCAGAAAGACATCTCCAAGAACCACCAG GTCCGCAAGCAGTACACCATCCAGGTCGGCGAGAACG | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Expression Profiles | Gene Chronologer Gene Chronologer (Grouped) Heterosis View Gene Correlator (coexpression analysis) SALK RiceGE Rice MPSS RiceArray Coexpression Database | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Miscellaneous | SNP data between Minghui 63 and Zhenshan 97 from OryzaSNP project: Putative homologies in ricePutative homologies in arabidopsis |