Browse Element(s) Details

Description

gb:AK119545.1
DB_XREF= gi:37989168
TID=Os.28216.2
CNT=124
FEA=FLmRNA
TIER=FL+Stack
STK=11
UG=Os.28216 (NCBI UniGene Cluster)
UG_TITLE=(japonica cultivar-group) chlorophyll ab binding protein (P0690B02.5), mRNA
DEF=Oryza sativa (japonica cultivar-group) cDNA clone:001-206-G05, full insert sequence.
FL= gb:AK119545.1 gb:AK104224.1 gb:AK061512.1 gb:AK119533.1 gb:AK103999.1 gb:AK103926.1 gb:AK104465.1 gb:AK109399.2 gb:AK104495.1 gb:AK068972.1
REP_ORG=O. sativa

Associated TIGR Gene Locus

TIGR Locus	Matching Probes	Description
LOC_Os07g37550	11/11	Chlorophyll a-b binding protein of LHCII type III, chloroplast precursor, putative, expressed

Gene Context (flanking 25kb)

TIGR Locus	Matching Probeset	Matching Probes	Chr	Strand	Coordinates	Description
LOC_Os07g37520	Os.40360.1.S1_x_at	1/11	7	+	22463955..22465440	hypothetical protein
LOC_Os07g37530	Os.46485.1.S1_at	9/11	7	+	22472867..22475482	Major Facilitator Superfamily protein, expressed
LOC_Os07g37530	OsAffx.10993.2.S1_x_at	1/11	7	+	22472867..22475482	Major Facilitator Superfamily protein, expressed
LOC_Os07g37530	OsAffx.10993.1.S1_x_at	1/11	7	+	22472867..22475482	Major Facilitator Superfamily protein, expressed
LOC_Os07g37540	OsAffx.5562.1.S1_at	11/11	7	+	22484437..22484763	hypothetical protein
LOC_Os07g37550	Os.28216.2.S1_s_at	11/11	7	+	22485740..22487030	Chlorophyll a-b binding protein of LHCII type III, chloroplast precursor, putative, expressed
LOC_Os07g37550	Os.28216.2.S1_a_at	8/11	7	+	22485740..22487030	Chlorophyll a-b binding protein of LHCII type III, chloroplast precursor, putative, expressed
LOC_Os07g37550	Os.28216.3.S1_x_at	3/11	7	+	22485740..22487030	Chlorophyll a-b binding protein of LHCII type III, chloroplast precursor, putative, expressed
LOC_Os07g37560	Os.10019.1.S1_a_at	11/11	7	+	22487133..22496733	Myosin head family protein, expressed
LOC_Os07g37570	Os.5422.1.S1_s_at	11/11	7	+	22504860..22507507	expressed protein
LOC_Os07g37570	OsAffx.16599.1.S1_at	11/11	7	+	22504860..22507507	expressed protein
LOC_Os07g37580	Os.10443.1.S1_at	8/11	7	+	22511401..22517062	Diacylglycerol kinase catalytic domain family protein, expressed

Gene Ontology Classification

GO id	Type	Name
GO:0009769	biological_process	photosynthesis, light harvesting in photosystem II
GO:0015979	biological_process	photosynthesis
GO:0030076	cellular_component	light-harvesting complex
GO:0042651	cellular_component	thylakoid membrane
GO:0005198	molecular_function	structural molecule activity
GO:0016168	molecular_function	chlorophyll binding

Probe Info

Probe Name	Hit(s)	Location	Sequence	TIGR Locus
Os.28216.2.S1_s_at--586--967	1	Chr07:22486741..22486765 (25 bp)	TCACGCCGGGCTCGTGAATGGCCCA	LOC_Os07g37550
Os.28216.2.S1_s_at--865--181	1	Chr07:22486743..22486767 (25 bp)	ACGCCGGGCTCGTGAATGGCCCAGC	LOC_Os07g37550
Os.28216.2.S1_s_at--247--759	1	Chr07:22486748..22486772 (25 bp)	GGGCTCGTGAATGGCCCAGCCGCCA	LOC_Os07g37550
Os.28216.2.S1_s_at--889--951	1	Chr07:22486788..22486812 (25 bp)	TCTCTCCATCGCTCGATGTACCAAT	LOC_Os07g37550
Os.28216.2.S1_s_at--791--923	1	Chr07:22486792..22486816 (25 bp)	TCCATCGCTCGATGTACCAATGCTT	LOC_Os07g37550
Os.28216.2.S1_s_at--783--433	1	Chr07:22486793..22486817 (25 bp)	CCATCGCTCGATGTACCAATGCTTG	LOC_Os07g37550
Os.28216.2.S1_s_at--1033--353	1	Chr07:22486794..22486818 (25 bp)	CATCGCTCGATGTACCAATGCTTGC	LOC_Os07g37550
Os.28216.2.S1_s_at--1023--51	1	Chr07:22486795..22486819 (25 bp)	ATCGCTCGATGTACCAATGCTTGCA	LOC_Os07g37550
Os.28216.2.S1_s_at--501--935	1	Chr07:22486796..22486820 (25 bp)	TCGCTCGATGTACCAATGCTTGCAC	LOC_Os07g37550
Os.28216.2.S1_s_at--228--947	1	Chr07:22486844..22486868 (25 bp)	TCTGATATGATCCATCCAGAATTCA	LOC_Os07g37550
Os.28216.2.S1_s_at--909--385	1	Chr07:22486845..22486869 (25 bp)	CTGATATGATCCATCCAGAATTCAG	LOC_Os07g37550

Target Sequence

TCACGCCGGGCTCGTGAATGGCCCAGCCGCCATTGTAGACTACTCTCTCTCTCCATCGCTCGATGTACCAATGCTTGCAC
AGATTGTACGATGCTGTGATGAATCTGATATGATCCATCCAGAATTCAG

Expression Profiles

Miscellaneous

SNP data between Minghui 63 and Zhenshan 97 from OryzaSNP project: