Os.16002.1.S1_at |
Description |
gb:CF322704 DB_XREF= gi:33793640 DB_XREF=HDN--01-N07.g1 CLONE=HDN--01-N07 TID=Os.16002.1 CNT=3 FEA=EST TIER=ConsEnd STK=0 UG=Os.16002 (NCBI UniGene Cluster) UG_TITLE=Transcribed sequence with weak similarity to protein ref:NP_567297.1 (A.thaliana) contains similarity to Medicago truncatula N7 protein REP_ORG=O. sativa | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Associated TIGR Gene Locus |
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Gene Context (flanking 25kb) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Gene Ontology Classification |
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Probe Info |
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Target Sequence | TATAATTAACCAAGTCTACGGCCGTTATGCTGATCGATCTGTTAGATGATGACTATACTACTCTGATTAACTATGCGTGG TAACTAC | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Expression Profiles | Gene Chronologer Gene Chronologer (Grouped) Heterosis View Gene Correlator (coexpression analysis) SALK RiceGE Rice MPSS RiceArray Coexpression Database | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Miscellaneous | SNP data between Minghui 63 and Zhenshan 97 from OryzaSNP project: Putative homologies in ricePutative homologies in arabidopsis |