CREP Browser

Description

gb:AK063976.1
DB_XREF= gi:32973994
TID=Os.33170.2
CNT=1
FEA=FLmRNA
TIER=FL
STK=1
UG=Os.33170 (NCBI UniGene Cluster)
UG_TITLE=(japonica cultivar-group) putative efflux carrier, pin3 (P0510C12.20), mRNA
DEF=Oryza sativa (japonica cultivar-group) cDNA clone:001-124-C02, full insert sequence.
FL= gb:AK063976.1
REP_ORG=O. sativa

Associated TIGR Gene Locus

TIGR Locus	Matching Probes	Description
LOC_Os01g45550	10/11	auxin efflux carrier protein, putative, expressed

Gene Context (flanking 25kb)

TIGR Locus	Matching Probeset	Matching Probes	Chr	Strand	Coordinates	Description
LOC_Os01g45520	OsAffx.23671.2.S1_x_at	11/11	1	+	26162999..26166831	D-mannose binding lectin family protein
LOC_Os01g45520	OsAffx.21804.2.S1_x_at	1/11	1	+	26162999..26166831	D-mannose binding lectin family protein
LOC_Os01g45530	Os.7466.1.S1_at	11/11	1	+	26168403..26170345	Single-strand binding protein family protein, expressed
LOC_Os01g45540	NA	NA	1	+	26185984..26186496	hypothetical protein
LOC_Os01g45550	Os.33170.1.S1_x_at	11/11	1	+	26190565..26195111	auxin efflux carrier protein, putative, expressed
LOC_Os01g45550	Os.33170.2.S1_at	10/11	1	+	26190565..26195111	auxin efflux carrier protein, putative, expressed
LOC_Os01g45559	NA	NA	1	+	26195673..26196175	NA
LOC_Os01g45570	Os.8170.1.S1_at	10/11	1	+	26207052..26210566	Homeobox associated leucine zipper family protein, expressed
LOC_Os01g45570	Os.8170.2.S1_x_at	10/11	1	+	26207052..26210566	Homeobox associated leucine zipper family protein, expressed
LOC_Os01g45580	NA	NA	1	+	26216076..26219312	transposon protein, putative, unclassified
LOC_Os01g45590	NA	NA	1	+	26219952..26226107	transposon protein, putative, unclassified

Gene Ontology Classification

GO id	Type	Name
GO:0007389	biological_process	pattern specification
GO:0009606	biological_process	tropism
GO:0009630	biological_process	gravitropism
GO:0009640	biological_process	photomorphogenesis
GO:0009926	biological_process	auxin polar transport
GO:0009942	biological_process	longitudinal axis specification
GO:0010082	biological_process	regulation of root meristem size
GO:0048364	biological_process	root development
GO:0048367	biological_process	shoot development
GO:0005737	cellular_component	cytoplasm
GO:0005886	cellular_component	plasma membrane
GO:0009925	cellular_component	basal plasma membrane
GO:0012506	cellular_component	vesicle membrane
GO:0016020	cellular_component	membrane
GO:0016328	cellular_component	lateral plasma membrane
GO:0045177	cellular_component	apical part of cell
GO:0005215	molecular_function	transporter activity
GO:0009672	molecular_function	auxin:hydrogen symporter activity

Probe Info

Probe Name	Hit(s)	Location	Sequence	TIGR Locus
Os.33170.2.S1_at--410--1079	1	NONE	TTGTTCAGGCGGCTCTACCACAAGG	NONE
Os.33170.2.S1_at--55--879	1	Chr01:26194627..26194646 (20 bp)	TGTTCAGGCGGCTCTACCACAAGGG	LOC_Os01g45550
Os.33170.2.S1_at--190--675	1	Chr01:26194627..26194647 (21 bp)	GTTCAGGCGGCTCTACCACAAGGGA	LOC_Os01g45550
Os.33170.2.S1_at--304--1051	1	Chr01:26194627..26194648 (22 bp)	TTCAGGCGGCTCTACCACAAGGGAT	LOC_Os01g45550
Os.33170.2.S1_at--240--963	1	Chr01:26194627..26194649 (23 bp)	TCAGGCGGCTCTACCACAAGGGATT	LOC_Os01g45550
Os.33170.2.S1_at--474--349	1	Chr01:26194627..26194650 (24 bp)	CAGGCGGCTCTACCACAAGGGATTG	LOC_Os01g45550
Os.33170.2.S1_at--531--91	1	Chr01:26194627..26194651 (25 bp)	AGGCGGCTCTACCACAAGGGATTGT	LOC_Os01g45550
Os.33170.2.S1_at--48--835	1	Chr01:26194628..26194652 (25 bp)	GGCGGCTCTACCACAAGGGATTGTG	LOC_Os01g45550
Os.33170.2.S1_at--1090--469	1	Chr01:26194629..26194653 (25 bp)	GCGGCTCTACCACAAGGGATTGTGC	LOC_Os01g45550
Os.33170.2.S1_at--1007--393	1	Chr01:26194630..26194654 (25 bp)	CGGCTCTACCACAAGGGATTGTGCC	LOC_Os01g45550
Os.33170.2.S1_at--358--831	1	Chr01:26194631..26194655 (25 bp)	GGCTCTACCACAAGGGATTGTGCCT	LOC_Os01g45550

Target Sequence

TTGTTCAGGCGGCTCTACCACAAGGGATTGTGCCT

Expression Profiles

Miscellaneous

SNP data between Minghui 63 and Zhenshan 97 from OryzaSNP project:

Browse Element(s) Details