Browse Element(s) Details

Os.3441.1.S1_at

Description

gb:AK060652.1
DB_XREF= gi:32970670
TID=Os.3441.1
CNT=42
FEA=FLmRNA
TIER=FL
STK=3
UG=Os.3441 (NCBI UniGene Cluster)
UG_TITLE=MRNA for voltage-dependent anion channel
DEF=Oryza sativa (japonica cultivar-group) cDNA clone:001-027-H05, full insert sequence.
FL= gb:AK061261.1 gb:AK060652.1
REP_ORG=O. sativa

Associated TIGR Gene Locus

TIGR Locus	Matching Probes	Description
LOC_Os09g19734	11/11	isochorismate synthases family protein, expressed

Gene Context (flanking 25kb)

TIGR Locus	Matching Probeset	Matching Probes	Chr	Strand	Coordinates	Description
LOC_Os09g19680	Os.10380.1.S1_at	4/11	9	+	11777331..11784017	ABC-type transport protein, putative, expressed
LOC_Os09g19690	OsAffx.6336.1.S1_at	11/11	9	+	11786006..11786278	hypothetical protein
LOC_Os09g19700	Os.8030.1.S1_at	11/11	9	+	11788181..11792358	Protein kinase APK1A, chloroplast precursor, putative, expressed
LOC_Os09g19710	Os.23381.1.A1_at	6/11	9	+	11795029..11797947	hypersensitive-induced response protein, putative, expressed
LOC_Os09g19720	Os.57110.1.S1_at	11/11	9	+	11798225..11799570	expressed protein
LOC_Os09g19734	Os.3441.1.S1_s_at	11/11	9	+	11804588..11814324	isochorismate synthases family protein, expressed
LOC_Os09g19734	Os.3441.1.S1_at	11/11	9	+	11804588..11814324	isochorismate synthases family protein, expressed
LOC_Os09g19734	Os.6334.1.S1_at	11/11	9	+	11804588..11814324	isochorismate synthases family protein, expressed
LOC_Os09g19734	Os.39720.1.A1_x_at	3/11	9	+	11804588..11814324	isochorismate synthases family protein, expressed
LOC_Os09g19750	Os.51582.1.S2_at	11/11	9	+	11817541..11820424	Uncharacterised protein family containing protein, expressed
LOC_Os09g19750	Os.56090.1.S1_at	11/11	9	+	11817541..11820424	Uncharacterised protein family containing protein, expressed
LOC_Os09g19750	OsAffx.29926.1.S1_s_at	11/11	9	+	11817541..11820424	Uncharacterised protein family containing protein, expressed
LOC_Os09g19750	Os.51582.1.S1_at	10/11	9	+	11817541..11820424	Uncharacterised protein family containing protein, expressed
LOC_Os09g19750	OsAffx.29926.1.S1_at	7/11	9	+	11817541..11820424	Uncharacterised protein family containing protein, expressed
LOC_Os09g19760	OsAffx.29927.1.S1_at	11/11	9	+	11825690..11825929	hypothetical protein
LOC_Os09g19769	NA	NA	9	+	11829099..11829284	NA
LOC_Os09g19780	NA	NA	9	+	11836068..11836760	hypothetical protein

Select all/Clear all

Gene Ontology Classification

GO id	Type	Name
GO:0006820	biological_process	anion transport
GO:0009617	biological_process	response to bacteria
GO:0009627	biological_process	systemic acquired resistance
GO:0009697	biological_process	salicylic acid biosynthesis
GO:0005739	cellular_component	mitochondrion
GO:0005741	cellular_component	mitochondrial outer membrane
GO:0009536	cellular_component	plastid
GO:0008308	molecular_function	voltage-gated ion-selective channel activity
GO:0008909	molecular_function	isochorismate synthase activity

Probe Info

Probe Name	Hit(s)	Location	Sequence	TIGR Locus
Os.3441.1.S1_at--65--497	1	Chr09:11807428..11807452 (25 bp)	GCATCTTATTACCACATTGTGAACC	LOC_Os09g19734
Os.3441.1.S1_at--379--999	1	Chr09:11807437..11807461 (25 bp)	TACCACATTGTGAACCATTCGGCCA	LOC_Os09g19734
Os.3441.1.S1_at--445--171	1	Chr09:11807438..11807462 (25 bp)	ACCACATTGTGAACCATTCGGCCAC	LOC_Os09g19734
Os.3441.1.S1_at--1014--205	1	Chr09:11807441..11807465 (25 bp)	ACATTGTGAACCATTCGGCCACAGC	LOC_Os09g19734
Os.3441.1.S1_at--615--3	1	Chr09:11807443..11807467 (25 bp)	ATTGTGAACCATTCGGCCACAGCTG	LOC_Os09g19734
Os.3441.1.S1_at--1073--1081	1	Chr09:11807444..11807468 (25 bp)	TTGTGAACCATTCGGCCACAGCTGT	LOC_Os09g19734
Os.3441.1.S1_at--155--543	1	Chr09:11807448..11807472 (25 bp)	GAACCATTCGGCCACAGCTGTTGGA	LOC_Os09g19734
Os.3441.1.S1_at--394--263	1	Chr09:11807449..11807473 (25 bp)	AACCATTCGGCCACAGCTGTTGGAG	LOC_Os09g19734
Os.3441.1.S1_at--37--433	1	Chr09:11807451..11807475 (25 bp)	CCATTCGGCCACAGCTGTTGGAGCT	LOC_Os09g19734
Os.3441.1.S1_at--298--11	1	Chr09:11807453..11807477 (25 bp)	ATTCGGCCACAGCTGTTGGAGCTGA	LOC_Os09g19734
Os.3441.1.S1_at--847--1059	1	Chr09:11807454..11807478 (25 bp)	TTCGGCCACAGCTGTTGGAGCTGAG	LOC_Os09g19734

Target Sequence

GCATCTTATTACCACATTGTGAACCATTCGGCCACAGCTGTTGGAGCTGAG

BLASTn GenBank NR

Expression Profiles

Gene Chronologer
Gene Chronologer (Grouped)
Heterosis View
Gene Correlator (coexpression analysis)
SALK RiceGE
Rice MPSS MPSS logo

RiceArray Coexpression Database

Miscellaneous

SNP data between Minghui 63 and Zhenshan 97 from OryzaSNP project:

Putative homologies in rice

Putative homologies in arabidopsis