OsAffx.27496.1.S1_x_at |
Description |
gb:NM_185680.1 DB_XREF= gi:34898445 TID=OsAffx.27496.1 CNT=2 FEA=mRNA TIER=ConsEnd STK=0 NOTE=sequence(s) not in UniGene DEF=Oryza sativa (japonica cultivar-group) Similar to Zea mays putative AC9 transposase. (P03010) (Gene), mRNA. REP_ORG=O. sativa | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Associated TIGR Gene Locus |
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Gene Context (flanking 25kb) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Gene Ontology Classification |
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Probe Info |
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Target Sequence | AGCACAGTTGCTTCAGAATCAGCTTTTAGCACTAATGGGAGAGTTCTTAGTGAGCATCGTAGTCGGCTCACTTCTAAGTT GTTAGAAGCTCTAATGTGCCAACAGGATTGGCTTCGAAACAAGTACAA | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Expression Profiles | Gene Chronologer Gene Chronologer (Grouped) Heterosis View Gene Correlator (coexpression analysis) SALK RiceGE Rice MPSS RiceArray Coexpression Database | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Miscellaneous | SNP data between Minghui 63 and Zhenshan 97 from OryzaSNP project: Putative homologies in ricePutative homologies in arabidopsis |