Description |
tigr:9634.m04686
TID=OsAffx.28164.2 CNT=1 FEA=mRNA TIER=ConsEnd STK=0 NOTE=sequence(s) not in UniGene DEF=peroxidase ATP22a REP_ORG=O. sativa |
Associated TIGR Gene Locus | TIGR Locus | Matching Probes | Description |
---|
LOC_Os06g48030 | 11/11 | Peroxidase 16 precursor, putative, expressed | LOC_Os02g01720 | 3/11 | expressed protein | LOC_Os02g56420 | 3/11 | wall-associated kinase 3, putative, expressed | LOC_Os10g31250 | 2/11 | expressed protein | LOC_Os02g01510 | 2/11 | L-lactate dehydrogenase A, putative, expressed | LOC_Os08g02830 | 2/11 | hypothetical protein | LOC_Os06g22919 | 2/11 | Xyloglucan endotransglucosylase/hydrolase protein 26precursor, putative, expressed | LOC_Os03g41438 | 2/11 | Protein Z, putative, expressed | LOC_Os07g40620 | 1/11 | saccharopine dehydrogenase family protein, expressed | LOC_Os04g53110 | 1/11 | hypothetical protein | LOC_Os01g23970 | 1/11 | serine/threonine kinase, putative | LOC_Os07g41060 | 1/11 | Dihydroflavonol-4-reductase, putative, expressed | LOC_Os05g30540 | 1/11 | retrotransposon protein, putative, unclassified | LOC_Os12g31230 | 1/11 | transposon protein, putative, CACTA, En/Spm sub-class | LOC_Os07g35750 | 1/11 | Protein kinase domain containing protein, expressed | LOC_Os09g39070 | 1/11 | Papain family cysteine protease containing protein, expressed | LOC_Os04g51330 | 1/11 | Maltose excess protein 1-like, chloroplast precursor, putative, expressed | LOC_Os08g17830 | 1/11 | transposon protein, putative, unclassified | LOC_Os06g01390 | 1/11 | Acyl-coenzyme A oxidase 1.2, peroxisomal, putative, expressed | LOC_Os12g17550 | 1/11 | Leucine Rich Repeat family protein, expressed | LOC_Os12g01449 | 1/11 | expressed protein | LOC_Os05g39370 | 1/11 | hypothetical protein | LOC_Os03g36630 | 1/11 | expressed protein | LOC_Os02g16709 | 1/11 | signal peptidase I family protein, expressed | LOC_Os03g49464 | 1/11 | pentatricopeptide, putative, expressed | LOC_Os03g17270 | 1/11 | expressed protein | LOC_Os12g40720 | 1/11 | hypothetical protein |
|
Gene Context (flanking 25kb) |
|
Gene Ontology Classification | GO id | Type | Name |
---|
GO:0001676 | biological_process | long-chain fatty acid metabolism | GO:0005983 | biological_process | starch catabolism | GO:0006412 | biological_process | protein biosynthesis | GO:0006468 | biological_process | protein amino acid phosphorylation | GO:0006508 | biological_process | proteolysis | GO:0006635 | biological_process | fatty acid beta-oxidation | GO:0006952 | biological_process | defense response | GO:0007154 | biological_process | cell communication | GO:0007165 | biological_process | signal transduction | GO:0007169 | biological_process | transmembrane receptor protein tyrosine kinase signaling pathway | GO:0007275 | biological_process | development | GO:0009414 | biological_process | response to water deprivation | GO:0009598 | biological_process | detection of pathogenic bacteria | GO:0009629 | biological_process | response to gravity | GO:0009737 | biological_process | response to abscisic acid stimulus | GO:0009751 | biological_process | response to salicylic acid stimulus | GO:0009809 | biological_process | lignin biosynthesis | GO:0009813 | biological_process | flavonoid biosynthesis | GO:0009964 | biological_process | negative regulation of flavonoid biosynthesis | GO:0050832 | biological_process | defense response to fungi | GO:0005618 | cellular_component | cell wall | GO:0005737 | cellular_component | cytoplasm | GO:0005739 | cellular_component | mitochondrion | GO:0005777 | cellular_component | peroxisome | GO:0005886 | cellular_component | plasma membrane | GO:0009706 | cellular_component | chloroplast inner membrane | GO:0016020 | cellular_component | membrane | GO:0042579 | cellular_component | microbody | GO:0003723 | molecular_function | RNA binding | GO:0003779 | molecular_function | actin binding | GO:0003997 | molecular_function | acyl-CoA oxidase activity | GO:0004022 | molecular_function | alcohol dehydrogenase activity | GO:0004457 | molecular_function | lactate dehydrogenase activity | GO:0004601 | molecular_function | peroxidase activity | GO:0004674 | molecular_function | protein serine/threonine kinase activity | GO:0004675 | molecular_function | transmembrane receptor protein serine/threonine kinase activity | GO:0004867 | molecular_function | serine-type endopeptidase inhibitor activity | GO:0005363 | molecular_function | maltose transporter activity | GO:0005515 | molecular_function | protein binding | GO:0005524 | molecular_function | ATP binding | GO:0008233 | molecular_function | peptidase activity | GO:0008234 | molecular_function | cysteine-type peptidase activity | GO:0016301 | molecular_function | kinase activity | GO:0016491 | molecular_function | oxidoreductase activity | GO:0016614 | molecular_function | oxidoreductase activity, acting on CH-OH group of donors | GO:0016615 | molecular_function | malate dehydrogenase activity | GO:0016621 | molecular_function | cinnamoyl-CoA reductase activity | GO:0016798 | molecular_function | hydrolase activity, acting on glycosyl bonds | GO:0030246 | molecular_function | carbohydrate binding | GO:0045551 | molecular_function | cinnamyl-alcohol dehydrogenase activity |
|
Probe Info |
|
Target Sequence | ATGATGTAAACTAGCGTGGTGGCCCACGCAGATTGCGCGGCTAACATTATTATATTTTCTCTCATATAATAGCATATATG
TTTTCTCATTATATTATTTAAATATATTAAAATAACAATATAATTTTAAATTTTGTAATAACTTTACAAAACTATTAATG
TGTAATATTCATATTATATTTTATATACGTGTTAGTTATTAATTATTTTTAATATCAAATTTTAGTTATTTGTAAATTAT
ATATATTCCTATATGAACTCTAGACTCGTCTTTTAATATTTCTTTTTTTTTAATTTTGAATTTTCTGTAAATTGTATTTC
TATATAGACTCTATGCTCTTCTTCTAATATTATTTAT BLASTn GenBank NR |
Expression Profiles | Gene Chronologer Gene Chronologer (Grouped) Heterosis View Gene Correlator (coexpression analysis) SALK RiceGE Rice MPSS RiceArray Coexpression Database |
Miscellaneous | SNP data between Minghui 63 and Zhenshan 97 from OryzaSNP project: Putative homologies in ricePutative homologies in arabidopsis |