Os.11554.1.S1_at |
Description |
gb:C20494 DB_XREF= gi:4714529 DB_XREF=C20494 CLONE=R1617 TID=Os.11554.1 CNT=2 FEA=EST TIER=ConsEnd STK=2 UG=Os.11554 (NCBI UniGene Cluster) UG_TITLE=Transcribed sequence with weak similarity to protein pir:T45730 (A.thaliana) T45730 peroxidase-like protein - Arabidopsis thaliana REP_ORG=O. sativa | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Associated TIGR Gene Locus |
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Gene Context (flanking 25kb) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Gene Ontology Classification |
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Probe Info |
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Target Sequence | GGCCAACACCCATTATTGATGCTCCTCTTGTTAATTATACTGTCGAGTACAACACAAATATGTTGGATACTCATTTGTAA GTGTGAAATTCCTTTCGATTTGATTGTGC | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Expression Profiles | Gene Chronologer Gene Chronologer (Grouped) Heterosis View Gene Correlator (coexpression analysis) SALK RiceGE Rice MPSS RiceArray Coexpression Database | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Miscellaneous | SNP data between Minghui 63 and Zhenshan 97 from OryzaSNP project: Putative homologies in ricePutative homologies in arabidopsis |