Browse Element(s) Details

Os.1386.1.S1_a_at

Description

gb:AK060445.1
DB_XREF= gi:32970463
TID=Os.1386.1
CNT=34
FEA=FLmRNA
TIER=FL
STK=2
UG=Os.1386 (NCBI UniGene Cluster)
UG_TITLE=(japonica cultivar-group) cDNA clone:001-011-E11, full insert sequence
DEF=Oryza sativa (japonica cultivar-group) cDNA clone:001-011-E11, full insert sequence.
FL= gb:AK060445.1
REP_ORG=O. sativa

Associated TIGR Gene Locus

TIGR Locus	Matching Probes	Description
LOC_Os09g39500	11/11	ubiquitin fusion protein, putative, expressed

Gene Context (flanking 25kb)

TIGR Locus	Matching Probeset	Matching Probes	Chr	Strand	Coordinates	Description
LOC_Os09g39420	Os.4904.1.S1_at	11/11	9	+	22665907..22670890	transducin family protein, putative, expressed
LOC_Os09g39430	Os.10528.1.S1_s_at	11/11	9	+	22671047..22674921	GDSL-like Lipase/Acylhydrolase family protein, expressed
LOC_Os09g39440	Os.15779.1.S1_at	11/11	9	+	22677079..22679783	Inosine-uridine preferring nucleoside hydrolase family protein, expressed
LOC_Os09g39450	OsAffx.18058.1.S1_at	9/11	9	+	22680901..22681972	hypothetical protein
LOC_Os09g39462	Os.12034.1.S1_a_at	11/11	9	+	22682047..22687249	expressed protein
LOC_Os09g39462	Os.12034.2.S1_at	11/11	9	+	22682047..22687249	expressed protein
LOC_Os09g39474	OsAffx.18059.1.S1_at	7/11	9	+	22687595..22689107	expressed protein
LOC_Os09g39490	OsAffx.6533.1.S1_at	11/11	9	+	22689793..22691494	Histone-like transcription factor and archaeal histone family protein, expressed
LOC_Os09g39490	OsAffx.6533.1.S1_x_at	11/11	9	+	22689793..22691494	Histone-like transcription factor and archaeal histone family protein, expressed
LOC_Os09g39500	Os.1386.1.S1_a_at	11/11	9	+	22692186..22694404	ubiquitin fusion protein, putative, expressed
LOC_Os09g39510	Os.55913.1.S1_at	10/11	9	+	22694639..22695664	Germin-like protein subfamily T member 2 precursor, putative, expressed
LOC_Os09g39520	OsAffx.30211.1.S1_at	11/11	9	+	22697264..22697908	Cupin family protein
LOC_Os09g39530	Os.30306.1.A1_at	11/11	9	+	22699440..22700478	Cupin family protein, expressed
LOC_Os09g39540	Os.37329.1.S1_at	9/11	9	+	22701259..22702623	40S ribosomal protein S25, putative, expressed
LOC_Os09g39550	Os.4188.1.S1_at	11/11	9	+	22702884..22705225	expressed protein
LOC_Os09g39560	Os.7132.1.S1_at	11/11	9	+	22707156..22709078	Genetic modifier, putative, expressed
LOC_Os09g39570	Os.5640.1.S1_at	11/11	9	+	22712810..22716059	Beta-amylase, putative, expressed
LOC_Os09g39580	Os.52848.1.S1_at	11/11	9	+	22716267..22719449	expressed protein

Select all/Clear all

Gene Ontology Classification

GO id	Type	Name
GO:0006464	biological_process	protein modification
GO:0006511	biological_process	ubiquitin-dependent protein catabolism
GO:0016567	biological_process	protein ubiquitination
GO:0005622	cellular_component	intracellular
GO:0005840	cellular_component	ribosome
GO:0003735	molecular_function	structural constituent of ribosome
GO:0005515	molecular_function	protein binding

Probe Info

Probe Name	Hit(s)	Location	Sequence	TIGR Locus
Os.1386.1.S1_a_at--1061--685	1	Chr09:22694122..22694146 (25 bp)	GTTTGAGATATCATTTCCGCGGATC	LOC_Os09g39500
Os.1386.1.S1_a_at--1148--1065	1	Chr09:22694136..22694160 (25 bp)	TTCCGCGGATCATTGAAATCAACAG	LOC_Os09g39500
Os.1386.1.S1_a_at--1125--1035	1	Chr09:22694180..22694204 (25 bp)	TTTTTGTAGTGTAATGCCTCATGTT	LOC_Os09g39500
Os.1386.1.S1_a_at--1007--445	1	Chr09:22694195..22694219 (25 bp)	GCCTCATGTTGTATGCCGAACTTTC	LOC_Os09g39500
Os.1386.1.S1_a_at--268--59	1	Chr09:22694207..22694231 (25 bp)	ATGCCGAACTTTCTGTTTATCCTGT	LOC_Os09g39500
Os.1386.1.S1_a_at--539--1043	1	Chr09:22694223..22694247 (25 bp)	TTATCCTGTTGTATGTTAACCTTGG	LOC_Os09g39500
Os.1386.1.S1_a_at--131--675	1	Chr09:22694237..22694261 (25 bp)	GTTAACCTTGGTTACGCTGGAGAGT	LOC_Os09g39500
Os.1386.1.S1_a_at--444--361	1	Chr09:22694242..22694266 (25 bp)	CCTTGGTTACGCTGGAGAGTACTCC	LOC_Os09g39500
Os.1386.1.S1_a_at--963--381	1	Chr09:22694263..22694287 (25 bp)	CTCCAGCTTATTTTGATGACATAAT	LOC_Os09g39500
Os.1386.1.S1_a_at--712--281	1	Chr09:22694296..22694320 (25 bp)	AAGTCAAGGTTATATGGCCCGGCCT	LOC_Os09g39500
Os.1386.1.S1_a_at--125--973	1	Chr09:22694299..22694323 (25 bp)	TCAAGGTTATATGGCCCGGCCTTAA	LOC_Os09g39500

Target Sequence

GTTTGAGATATCATTTCCGCGGATCATTGAAATCAACAGGAAGATCAGAGTTTAAGTTTTTTTGTAGTGTAATGCCTCAT
GTTGTATGCCGAACTTTCTGTTTATCCTGTTGTATGTTAACCTTGGTTACGCTGGAGAGTACTCCAGCTTATTTTGATGA
CATAATTGACTACAAAGTCAAGGTTATATGGCCCGGCCTTAA

BLASTn GenBank NR

Expression Profiles

Gene Chronologer
Gene Chronologer (Grouped)
Heterosis View
Gene Correlator (coexpression analysis)
SALK RiceGE
Rice MPSS MPSS logo

RiceArray Coexpression Database

Miscellaneous

SNP data between Minghui 63 and Zhenshan 97 from OryzaSNP project:

Putative homologies in rice

Putative homologies in arabidopsis