Os.18238.1.S1_at |
Description |
gb:C98588 DB_XREF= gi:3761340 DB_XREF=C98588 CLONE=E0437_6Z TID=Os.18238.1 CNT=1 FEA=EST TIER=ConsEnd STK=1 UG=Os.18238 (NCBI UniGene Cluster) UG_TITLE=Transcribed sequence with weak similarity to protein pir:T45624 (A.thaliana) T45624 flavonoid 3-hydroxylase-like protein (imported) - Arabidopsis thaliana REP_ORG=O. sativa | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Associated TIGR Gene Locus |
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Gene Context (flanking 25kb) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Gene Ontology Classification |
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Probe Info |
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Target Sequence | AATAATTCATGCACTGACGGGCCGCATGCATGTATGCTCGTATGTGCGCTCTCTCTCTCTCTCTCTGAGTTCATAGTTAT ATTTTACTGCAGAGTACTTGTTTATTTATCGATCTACACGCAGATGATAAACGGAGTACAGT | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Expression Profiles | Gene Chronologer Gene Chronologer (Grouped) Heterosis View Gene Correlator (coexpression analysis) SALK RiceGE Rice MPSS RiceArray Coexpression Database | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Miscellaneous | SNP data between Minghui 63 and Zhenshan 97 from OryzaSNP project: Putative homologies in ricePutative homologies in arabidopsis |