Browse Element(s) Details

Os.23290.2.S1_s_at

Description

gb:NM_197724.1
DB_XREF= gi:37536807
TID=Os.23290.2
CNT=1
FEA=mRNA
TIER=ConsEnd
STK=0
UG=Os.23290 (NCBI UniGene Cluster)
DEF=Oryza sativa (japonica cultivar-group) putative ethylene-forming enzyme (OSJNBa0042H09.23), mRNA.
PROD=putative ethylene-forming enzyme
REP_ORG=O. sativa

Associated TIGR Gene Locus

TIGR Locus	Matching Probes	Description
LOC_Os10g40960	11/11	oxidoreductase, 2OG-Fe oxygenase family protein, expressed
LOC_Os11g03510	11/11	1-aminocyclopropane-1-carboxylate oxidase 1, putative

Gene Context (flanking 25kb)

TIGR Locus	Matching Probeset	Matching Probes	Chr	Strand	Coordinates	Description
LOC_Os10g40890	OsAffx.7914.1.S1_at	11/11	10	+	21642155..21647340	retrotransposon protein, putative, unclassified
LOC_Os10g40900	OsAffx.20137.1.S1_at	11/11	10	+	21649422..21652233	oxidoreductase, 2OG-Fe oxygenase family protein
LOC_Os10g40900	Os.13877.1.S1_at	1/11	10	+	21649422..21652233	oxidoreductase, 2OG-Fe oxygenase family protein
LOC_Os10g40920	OsAffx.6932.1.S1_at	11/11	10	+	21654252..21657630	pentatricopeptide, putative, expressed
LOC_Os10g40934	Os.28435.4.S1_x_at	11/11	10	+	21658835..21664003	oxidoreductase, 2OG-Fe oxygenase family protein, expressed
LOC_Os10g40934	Os.28435.1.S1_a_at	11/11	10	+	21658835..21664003	oxidoreductase, 2OG-Fe oxygenase family protein, expressed
LOC_Os10g40934	Os.28435.5.S1_x_at	11/11	10	+	21658835..21664003	oxidoreductase, 2OG-Fe oxygenase family protein, expressed
LOC_Os10g40934	Os.28435.4.S1_at	11/11	10	+	21658835..21664003	oxidoreductase, 2OG-Fe oxygenase family protein, expressed
LOC_Os10g40934	Os.28435.5.S1_at	11/11	10	+	21658835..21664003	oxidoreductase, 2OG-Fe oxygenase family protein, expressed
LOC_Os10g40934	Os.23290.2.S1_x_at	2/11	10	+	21658835..21664003	oxidoreductase, 2OG-Fe oxygenase family protein, expressed
LOC_Os10g40950	Os.46622.1.S1_x_at	11/11	10	+	21664458..21665479	Major myo-inositol transporter iolT, putative, expressed
LOC_Os10g40950	OsAffx.26978.1.S1_at	1/11	10	+	21664458..21665479	Major myo-inositol transporter iolT, putative, expressed
LOC_Os10g40960	Os.23290.2.S1_s_at	11/11	10	+	21665876..21667896	oxidoreductase, 2OG-Fe oxygenase family protein, expressed
LOC_Os10g40960	Os.23290.2.S1_x_at	10/11	10	+	21665876..21667896	oxidoreductase, 2OG-Fe oxygenase family protein, expressed
LOC_Os10g40960	Os.23290.1.S1_at	10/11	10	+	21665876..21667896	oxidoreductase, 2OG-Fe oxygenase family protein, expressed
LOC_Os10g40960	Os.28435.5.S1_at	1/11	10	+	21665876..21667896	oxidoreductase, 2OG-Fe oxygenase family protein, expressed
LOC_Os10g40960	Os.28435.5.S1_x_at	1/11	10	+	21665876..21667896	oxidoreductase, 2OG-Fe oxygenase family protein, expressed
LOC_Os10g40990	Os.52326.1.S1_at	11/11	10	+	21682883..21684635	Flavonol synthase/flavanone 3-hydroxylase, putative, expressed
LOC_Os10g40990	Os.28435.5.S1_at	2/11	10	+	21682883..21684635	Flavonol synthase/flavanone 3-hydroxylase, putative, expressed
LOC_Os10g40990	Os.8575.1.S1_at	1/11	10	+	21682883..21684635	Flavonol synthase/flavanone 3-hydroxylase, putative, expressed
LOC_Os10g41000	Os.52220.1.S1_at	11/11	10	+	21685261..21689413	retrotransposon protein, putative, unclassified, expressed
LOC_Os10g41000	Os.51877.1.S1_x_at	11/11	10	+	21685261..21689413	retrotransposon protein, putative, unclassified, expressed
LOC_Os10g41020	Os.7510.1.S1_at	11/11	10	+	21690027..21693601	oxidoreductase, 2OG-Fe oxygenase family protein, expressed
LOC_Os10g41020	Os.7510.1.S2_at	11/11	10	+	21690027..21693601	oxidoreductase, 2OG-Fe oxygenase family protein, expressed
LOC_Os10g41020	Os.51877.1.S1_x_at	1/11	10	+	21690027..21693601	oxidoreductase, 2OG-Fe oxygenase family protein, expressed

Select all/Clear all

Gene Ontology Classification

GO id	Type	Name
GO:0009813	biological_process	flavonoid biosynthesis
GO:0010261	biological_process	organ senescence (sensu Magnoliophyta)
GO:0016682	molecular_function	oxidoreductase activity, acting on diphenols and related substances as donors, oxygen as acceptor
GO:0016706	molecular_function	oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, 2-oxoglutarate as one donor, and incorporation of one atom each of oxygen into both donors

Probe Info

Probe Name	Hit(s)	Location	Sequence	TIGR Locus
Os.23290.2.S1_s_at--478--281	2	Chr11:1357844..1357868 (25 bp)	AAGTGTATTTGAAGGGCAAGCTAGG	LOC_Os11g03510
Os.23290.2.S1_s_at--167--767	2	Chr11:1357868..1357892 (25 bp)	GGGTTTGAGGATGAACTACTATCCA	LOC_Os11g03510
Os.23290.2.S1_s_at--75--631	2	Chr11:1357877..1357901 (25 bp)	GATGAACTACTATCCACCGTGCTTG	LOC_Os11g03510
Os.23290.2.S1_s_at--393--223	2	Chr11:1357909..1357933 (25 bp)	ACAAGGTGTTGGGTTTGTCACCGCA	LOC_Os11g03510
Os.23290.2.S1_s_at--287--105	2	Chr11:1357912..1357936 (25 bp)	AGGTGTTGGGTTTGTCACCGCACAC	LOC_Os11g03510
Os.23290.2.S1_s_at--857--881	2	Chr11:1357915..1357939 (25 bp)	TGTTGGGTTTGTCACCGCACACTGA	LOC_Os11g03510
Os.23290.2.S1_s_at--423--1085	2	Chr11:1357917..1357941 (25 bp)	TTGGGTTTGTCACCGCACACTGATC	LOC_Os11g03510
Os.23290.2.S1_s_at--536--849	2	Chr11:1357946..1357970 (25 bp)	TGGCTTGACACTGCTTCTCCAGGTG	LOC_Os11g03510
Os.23290.2.S1_s_at--363--1075	2	Chr11:1357950..1357974 (25 bp)	TTGACACTGCTTCTCCAGGTGAATG	LOC_Os11g03510
Os.23290.2.S1_s_at--707--563	2	Chr11:1357952..1357976 (25 bp)	GACACTGCTTCTCCAGGTGAATGAT	LOC_Os11g03510
Os.23290.2.S1_s_at--700--333	2	Chr11:1357954..1357978 (25 bp)	CACTGCTTCTCCAGGTGAATGATGT	LOC_Os11g03510

Target Sequence

AAGTGTATTTGAAGGGCAAGCTAGGGGTTTGAGGATGAACTACTATCCACCGTGCTTGAAAGCTGACAAGGTGTTGGGTT
TGTCACCGCACACTGATCCAGGTGGCTTGACACTGCTTCTCCAGGTGAATGATGT

BLASTn GenBank NR

Expression Profiles

Gene Chronologer
Gene Chronologer (Grouped)
Heterosis View
Gene Correlator (coexpression analysis)
SALK RiceGE
Rice MPSS MPSS logo

RiceArray Coexpression Database

Miscellaneous

SNP data between Minghui 63 and Zhenshan 97 from OryzaSNP project:

Putative homologies in rice

Putative homologies in arabidopsis