Browse Element(s) Details

Os.55414.1.S1_at

Description

gb:AK108042.1
DB_XREF= gi:32993251
TID=Os.55414.1
CNT=1
FEA=FLmRNA
TIER=FL
STK=1
UG=Os.55414 (NCBI UniGene Cluster)
UG_TITLE=(japonica cultivar-group) cDNA clone:002-137-D10, full insert sequence
DEF=Oryza sativa (japonica cultivar-group) cDNA clone:002-137-D10, full insert sequence.
FL= gb:AK108042.1
REP_ORG=O. sativa

Associated TIGR Gene Locus

TIGR Locus	Matching Probes	Description
LOC_Os12g40590	11/11	Helix-loop-helix DNA-binding domain containing protein, expressed
LOC_Os12g44250	2/11	Synaptobrevin family protein, expressed
LOC_Os05g46070	2/11	hAT dimerisation domain-containing protein, putative
LOC_Os02g14150	1/11	hAT family dimerisation domain containing protein

Gene Context (flanking 25kb)

TIGR Locus	Matching Probeset	Matching Probes	Chr	Strand	Coordinates	Description
LOC_Os12g40550	Os.15144.1.S1_a_at	11/11	12	+	25053401..25058014	amidase, hydantoinase/carbamoylase family protein, expressed
LOC_Os12g40560	Os.8370.1.S1_at	11/11	12	+	25058218..25064696	FLK, putative, expressed
LOC_Os12g40570	Os.19013.1.S1_at	11/11	12	+	25067430..25070610	WRKY DNA binding domain containing protein, expressed
LOC_Os12g40580	NA	NA	12	+	25080253..25080552	retrotransposon protein, putative, unclassified
LOC_Os12g40590	Os.55414.1.S1_at	11/11	12	+	25082483..25086214	Helix-loop-helix DNA-binding domain containing protein, expressed
LOC_Os12g40600	Os.26886.6.S1_s_at	10/11	12	+	25095558..25098312	transposon protein, putative, CACTA, En/Spm sub-class
LOC_Os12g40600	Os.26886.2.S1_s_at	10/11	12	+	25095558..25098312	transposon protein, putative, CACTA, En/Spm sub-class
LOC_Os12g40600	OsAffx.16467.1.S1_at	5/11	12	+	25095558..25098312	transposon protein, putative, CACTA, En/Spm sub-class
LOC_Os12g40610	Os.26886.1.S1_x_at	7/11	12	+	25100961..25104276	transposon protein, putative, CACTA, En/Spm sub-class
LOC_Os12g40610	Os.26886.3.S1_x_at	5/11	12	+	25100961..25104276	transposon protein, putative, CACTA, En/Spm sub-class
LOC_Os12g40619	NA	NA	12	+	25105856..25106098	hypothetical protein
LOC_Os12g40630	OsAffx.20055.1.S1_at	11/11	12	+	25109231..25114650	Helix-loop-helix DNA-binding domain containing protein

Select all/Clear all

Gene Ontology Classification

GO id	Type	Name
GO:0007165	biological_process	signal transduction
GO:0009639	biological_process	response to red or far red light
GO:0010017	biological_process	red or far red light signaling pathway
GO:0010161	biological_process	red light signaling pathway
GO:0005634	cellular_component	nucleus
GO:0005768	cellular_component	endosome
GO:0005886	cellular_component	plasma membrane
GO:0016020	cellular_component	membrane
GO:0003677	molecular_function	DNA binding
GO:0003700	molecular_function	transcription factor activity
GO:0005515	molecular_function	protein binding
GO:0030528	molecular_function	transcription regulator activity

Probe Info

Probe Name	Hit(s)	Location	Sequence	TIGR Locus
Os.55414.1.S1_at--643--707	1	Chr12:25085769..25085793 (25 bp)	GTAATCTAGTACCTCATCCAATGTT	LOC_Os12g40590
Os.55414.1.S1_at--1090--517	1	Chr12:25085829..25085853 (25 bp)	GCAAGTGAGTTTATCAGATTCTTCG	LOC_Os12g40590
Os.55414.1.S1_at--1042--125	1	Chr12:25085844..25085868 (25 bp)	AGATTCTTCGATGTCCGCACCTGGG	LOC_Os12g40590
Os.55414.1.S1_at--412--419	2	Chr12:25085858..25085882 (25 bp)	CCGCACCTGGGATTCTGAAGTTTTT	LOC_Os12g40590
Os.55414.1.S1_at--120--121	1	Chr12:25085876..25085900 (25 bp)	AGTTTTTTATGGATGCGGATTTCTA	LOC_Os12g40590
Os.55414.1.S1_at--539--987	5	Chr12:25085939..25085963 (25 bp)	TACATGTGACGGTAGCTTCAGCTGA	LOC_Os12g40590
Os.55414.1.S1_at--396--229	2	Chr12:25086030..25086054 (25 bp)	AAATGGCTTGACTATGTGCTTAATC	LOC_Os12g40590
Os.55414.1.S1_at--387--795	15	Chr12:27406520..27406544 (25 bp)	GGATATCTTGGACACTATTGATCTT	LOC_Os12g44250
Os.55414.1.S1_at--765--641	8	Chr12:25086079..25086103 (25 bp)	GATCTTAATACCGTTCTTGATGATT	LOC_Os12g40590
Os.55414.1.S1_at--316--655	15	Chr12:27406560..27406584 (25 bp)	GATTTTGCATCAAGAAATGCCCGAA	LOC_Os12g44250
Os.55414.1.S1_at--110--651	1	Chr12:25086156..25086180 (25 bp)	GATAGGGTTCTATTCTTTATTAAGT	LOC_Os12g40590

Target Sequence

GTAATCTAGTACCTCATCCAATGTTGAGATCAATGATTTTTATTCGGAATTAAAGGTGTTGCAAGTGAGTTTATCAGATT
CTTCGATGTCCGCACCTGGGATTCTGAAGTTTTTTATGGATGCGGATTTCTATAAAAATGTTTCAGTTGCCTATCGAATT
CTCTTAACCGTACATGTGACGGTAGCTTCAGCTGAAAGAAGTTTCTCAAAATTAAAGTTGTTGAAGAACTATTTGAGATC
AACTAAGTCGCAAGAAAGGTTAAATGGCTTGACTATGTGCTTAATCAAGAAGGATATCTTGGACACTATTGATCTTAATA
CCGTTCTTGATGATTTTGCATCAAGAAATGCCCGAAGAAGTATCTTTTCATAGGAAGCAATGGATATGATAGGGTTCTAT
TCTTTATTAAGT

BLASTn GenBank NR

Expression Profiles

Gene Chronologer
Gene Chronologer (Grouped)
Heterosis View
Gene Correlator (coexpression analysis)
SALK RiceGE
Rice MPSS MPSS logo

RiceArray Coexpression Database

Miscellaneous

SNP data between Minghui 63 and Zhenshan 97 from OryzaSNP project:

Putative homologies in rice

Putative homologies in arabidopsis