Browse Element(s) Details

OsAffx.3706.1.S1_at

Description

tigr:9632.m00206
TID=OsAffx.3706.1
CNT=1
FEA=mRNA
TIER=ConsEnd
STK=0
NOTE=sequence(s) not in UniGene
DEF=hypothetical protein
REP_ORG=O. sativa

Associated TIGR Gene Locus

TIGR Locus	Matching Probes	Description
LOC_Os04g02990	11/11	subtilisin-like protease, putative

Gene Context (flanking 25kb)

TIGR Locus	Matching Probeset	Matching Probes	Chr	Strand	Coordinates	Description
LOC_Os04g02960	OsAffx.10637.1.S1_s_at	11/11	4	+	1171439..1184186	retrotransposon protein, putative, Ty1-copia subclass
LOC_Os04g02960	OsAffx.10637.3.S1_s_at	11/11	4	+	1171439..1184186	retrotransposon protein, putative, Ty1-copia subclass
LOC_Os04g02960	OsAffx.10637.4.S1_s_at	8/11	4	+	1171439..1184186	retrotransposon protein, putative, Ty1-copia subclass
LOC_Os04g02960	OsAffx.19542.3.S1_x_at	3/11	4	+	1171439..1184186	retrotransposon protein, putative, Ty1-copia subclass
LOC_Os04g02960	OsAffx.9949.1.S1_at	1/11	4	+	1171439..1184186	retrotransposon protein, putative, Ty1-copia subclass
LOC_Os04g02970	OsAffx.25846.1.S1_s_at	11/11	4	+	1188292..1190004	Cucumisin precursor, putative, expressed
LOC_Os04g02980	OsAffx.25853.1.S1_at	11/11	4	+	1196587..1206116	Subtilisin N-terminal Region family protein
LOC_Os04g02990	OsAffx.3706.1.S1_at	11/11	4	+	1208003..1208519	subtilisin-like protease, putative
LOC_Os04g03000	OsAffx.13631.4.S1_s_at	11/11	4	+	1208996..1211441	hAT family dimerisation domain containing protein
LOC_Os04g03010	NA	NA	4	+	1213583..1214698	hypothetical protein
LOC_Os04g03020	OsAffx.13632.1.S1_at	11/11	4	+	1216992..1220535	hypothetical protein
LOC_Os04g03030	OsAffx.25936.1.S1_s_at	9/11	4	+	1223537..1226575	transposon protein, putative, CACTA, En/Spm sub-class
LOC_Os04g03030	OsAffx.25936.7.S1_s_at	8/11	4	+	1223537..1226575	transposon protein, putative, CACTA, En/Spm sub-class
LOC_Os04g03030	OsAffx.25936.2.S1_x_at	4/11	4	+	1223537..1226575	transposon protein, putative, CACTA, En/Spm sub-class
LOC_Os04g03030	OsAffx.25936.5.S1_x_at	2/11	4	+	1223537..1226575	transposon protein, putative, CACTA, En/Spm sub-class
LOC_Os04g03040	Os.10827.1.S1_x_at	9/11	4	+	1229730..1233017	transposon protein, putative, CACTA, En/Spm sub-class
LOC_Os04g03040	Os.46055.2.S1_x_at	5/11	4	+	1229730..1233017	transposon protein, putative, CACTA, En/Spm sub-class

Select all/Clear all

Gene Ontology Classification

GO id	Type	Name
GO:0006508	biological_process	proteolysis
GO:0009733	biological_process	response to auxin stimulus
GO:0010102	biological_process	lateral root morphogenesis
GO:0004289	molecular_function	subtilase activity
GO:0004291	molecular_function	subtilisin activity

Probe Info

Probe Name	Hit(s)	Location	Sequence	TIGR Locus
OsAffx.3706.1.S1_at--812--919	1	Chr04:1208284..1208308 (25 bp)	TGCCAGTACGAAACATCCCAAAGGT	LOC_Os04g02990
OsAffx.3706.1.S1_at--191--987	1	Chr04:1208290..1208314 (25 bp)	TACGAAACATCCCAAAGGTTGCCGA	LOC_Os04g02990
OsAffx.3706.1.S1_at--912--853	1	Chr04:1208327..1208351 (25 bp)	TGGAGCAGGTTTTATTAATCCAAAC	LOC_Os04g02990
OsAffx.3706.1.S1_at--72--643	1	Chr04:1208361..1208385 (25 bp)	GATCTAGGGCTCATCTATGACATCG	LOC_Os04g02990
OsAffx.3706.1.S1_at--1159--1007	1	Chr04:1208365..1208389 (25 bp)	TAGGGCTCATCTATGACATCGCTGC	LOC_Os04g02990
OsAffx.3706.1.S1_at--203--355	1	Chr04:1208372..1208396 (25 bp)	CATCTATGACATCGCTGCATCTAAC	LOC_Os04g02990
OsAffx.3706.1.S1_at--732--895	1	Chr04:1208378..1208402 (25 bp)	TGACATCGCTGCATCTAACTATCTC	LOC_Os04g02990
OsAffx.3706.1.S1_at--307--53	1	Chr04:1208382..1208406 (25 bp)	ATCGCTGCATCTAACTATCTCAAGT	LOC_Os04g02990
OsAffx.3706.1.S1_at--629--905	1	Chr04:1208387..1208411 (25 bp)	TGCATCTAACTATCTCAAGTTCTTC	LOC_Os04g02990
OsAffx.3706.1.S1_at--500--325	1	Chr04:1208411..1208435 (25 bp)	CAACTGCATCGGAGGATTAGCCACA	LOC_Os04g02990
OsAffx.3706.1.S1_at--1136--761	1	Chr04:1208437..1208461 (25 bp)	GGGACAACTGCACAACGGCGAAAAG	LOC_Os04g02990

Target Sequence

TGCCAGTACGAAACATCCCAAAGGTTGCCGACCCTTTCGATTATGGAGCAGGTTTTATTAATCCAAACATGGCAGCTGAT
CTAGGGCTCATCTATGACATCGCTGCATCTAACTATCTCAAGTTCTTCAACTGCATCGGAGGATTAGCCACAGGGGACAA
CTGCACAACGGCGAAAAG

BLASTn GenBank NR

Expression Profiles

Gene Chronologer
Gene Chronologer (Grouped)
Heterosis View
Gene Correlator (coexpression analysis)
SALK RiceGE
Rice MPSS MPSS logo

RiceArray Coexpression Database

Miscellaneous

SNP data between Minghui 63 and Zhenshan 97 from OryzaSNP project:

Putative homologies in rice

Putative homologies in arabidopsis