Browse Element(s) Details

OsAffx.13678.2.S1_at

Description

tigr:9632.m00446
TID=OsAffx.13678.2
CNT=1
FEA=mRNA
TIER=ConsEnd
STK=0
NOTE=sequence(s) not in UniGene
DEF=hypothetical protein
REP_ORG=O. sativa

Associated TIGR Gene Locus

TIGR Locus	Matching Probes	Description
LOC_Os04g05350	11/11	hypothetical protein
LOC_Os01g51860	1/11	violaxanthin de-epoxidase, putative, expressed

Gene Context (flanking 25kb)

TIGR Locus	Matching Probeset	Matching Probes	Chr	Strand	Coordinates	Description
LOC_Os04g05300	OsAffx.22896.1.S1_x_at	1/11	4	+	2625269..2628451	retrotransposon protein, putative, Ty3-gypsy subclass
LOC_Os04g05310	OsAffx.13677.1.S1_x_at	11/11	4	+	2629119..2633446	retrotransposon protein, putative, unclassified
LOC_Os04g05310	OsAffx.20695.1.S1_x_at	1/11	4	+	2629119..2633446	retrotransposon protein, putative, unclassified
LOC_Os04g05310	OsAffx.28492.1.S1_at	1/11	4	+	2629119..2633446	retrotransposon protein, putative, unclassified
LOC_Os04g05330	Os.38764.1.S1_x_at	8/11	4	+	2636256..2641781	Protein kinase domain containing protein
LOC_Os04g05330	Os.10731.1.A1_a_at	8/11	4	+	2636256..2641781	Protein kinase domain containing protein
LOC_Os04g05330	Os.46610.1.S1_x_at	5/11	4	+	2636256..2641781	Protein kinase domain containing protein
LOC_Os04g05330	OsAffx.8469.1.A1_x_at	3/11	4	+	2636256..2641781	Protein kinase domain containing protein
LOC_Os04g05330	Os.45173.1.S1_x_at	2/11	4	+	2636256..2641781	Protein kinase domain containing protein
LOC_Os04g05330	Os.48015.1.A1_x_at	2/11	4	+	2636256..2641781	Protein kinase domain containing protein
LOC_Os04g05330	Os.47999.2.A1_x_at	1/11	4	+	2636256..2641781	Protein kinase domain containing protein
LOC_Os04g05330	Os.53292.1.S1_x_at	1/11	4	+	2636256..2641781	Protein kinase domain containing protein
LOC_Os04g05330	Os.53292.1.S1_at	1/11	4	+	2636256..2641781	Protein kinase domain containing protein
LOC_Os04g05340	Os.10731.1.A1_a_at	9/11	4	+	2643297..2647062	retrotransposon protein, putative, unclassified
LOC_Os04g05340	Os.38764.1.S1_x_at	8/11	4	+	2643297..2647062	retrotransposon protein, putative, unclassified
LOC_Os04g05340	Os.46610.1.S1_x_at	5/11	4	+	2643297..2647062	retrotransposon protein, putative, unclassified
LOC_Os04g05340	OsAffx.31869.5.S1_x_at	4/11	4	+	2643297..2647062	retrotransposon protein, putative, unclassified
LOC_Os04g05340	OsAffx.31869.1.S1_at	4/11	4	+	2643297..2647062	retrotransposon protein, putative, unclassified
LOC_Os04g05340	OsAffx.31869.3.S1_s_at	3/11	4	+	2643297..2647062	retrotransposon protein, putative, unclassified
LOC_Os04g05340	OsAffx.8469.1.A1_x_at	3/11	4	+	2643297..2647062	retrotransposon protein, putative, unclassified
LOC_Os04g05340	Os.48015.1.A1_x_at	2/11	4	+	2643297..2647062	retrotransposon protein, putative, unclassified
LOC_Os04g05340	Os.45173.1.S1_x_at	2/11	4	+	2643297..2647062	retrotransposon protein, putative, unclassified
LOC_Os04g05340	OsAffx.31869.4.S1_x_at	2/11	4	+	2643297..2647062	retrotransposon protein, putative, unclassified
LOC_Os04g05340	Os.53292.1.S1_x_at	1/11	4	+	2643297..2647062	retrotransposon protein, putative, unclassified
LOC_Os04g05340	Os.47999.2.A1_x_at	1/11	4	+	2643297..2647062	retrotransposon protein, putative, unclassified
LOC_Os04g05340	OsAffx.31869.4.S1_at	1/11	4	+	2643297..2647062	retrotransposon protein, putative, unclassified
LOC_Os04g05340	Os.53292.1.S1_at	1/11	4	+	2643297..2647062	retrotransposon protein, putative, unclassified
LOC_Os04g05350	OsAffx.13678.2.S1_at	11/11	4	+	2649419..2650906	hypothetical protein
LOC_Os04g05360	OsAffx.25879.2.S1_at	11/11	4	+	2654705..2656990	hypothetical protein
LOC_Os04g05370	OsAffx.22896.1.S1_x_at	1/11	4	+	2663112..2676270	retrotransposon protein, putative, unclassified

Select all/Clear all

Gene Ontology Classification

GO id	Type	Name
GO:0009408	biological_process	response to heat
GO:0010028	biological_process	xanthophyll cycle
GO:0016122	biological_process	xanthophyll metabolism
GO:0009543	cellular_component	thylakoid lumen (sensu Viridiplantae)
GO:0030095	cellular_component	photosystem II (sensu Viridiplantae)
GO:0046422	molecular_function	violaxanthin de-epoxidase activity

Probe Info

Probe Name	Hit(s)	Location	Sequence	TIGR Locus
OsAffx.13678.2.S1_at--480--95	1	Chr04:2649861..2649885 (25 bp)	AGGACGTCTGGTACGACCTTGCCAA	LOC_Os04g05350
OsAffx.13678.2.S1_at--16--641	1	Chr04:2649947..2650120 (25 bp)	GATCGTGTCATGGAGCAGGCAGAAA	LOC_Os04g05350
OsAffx.13678.2.S1_at--556--879	1	Chr04:2650130..2650154 (25 bp)	TGTTCTTGAGGTTAGTTCGCGACGA	LOC_Os04g05350
OsAffx.13678.2.S1_at--593--321	1	Chr04:2650215..2650239 (25 bp)	CAAGGCAGAGACCACCGAGTATGTT	LOC_Os04g05350
OsAffx.13678.2.S1_at--168--545	1	Chr04:2650285..2650390 (25 bp)	GAACGTCCCTACATGAAAACACAGA	LOC_Os04g05350
OsAffx.13678.2.S1_at--1041--241	1	Chr04:2650381..2650405 (25 bp)	AAAACACAGAGCCTTGCCAAGCAGC	LOC_Os04g05350
OsAffx.13678.2.S1_at--949--323	1	Chr04:2650398..2650422 (25 bp)	CAAGCAGCTGGGAGTCACCGACCGG	LOC_Os04g05350
OsAffx.13678.2.S1_at--565--117	1	Chr04:2650429..2650453 (25 bp)	AGTAAGGTCTCGCTCAATGCTCTGC	LOC_Os04g05350
OsAffx.13678.2.S1_at--1037--755	2	Chr04:2650496..2650520 (25 bp)	GGGCCAGTGTGGAATTTCTGTTCAA	LOC_Os04g05350
OsAffx.13678.2.S1_at--329--829	1	Chr04:2650722..2650746 (25 bp)	GGCTTGTAACTCTTGTCTTGGCCAA	LOC_Os04g05350
OsAffx.13678.2.S1_at--1133--269	1	Chr04:2650745..2650769 (25 bp)	AAGCTCAGCCTTGCTAGTCACATGC	LOC_Os04g05350

Target Sequence

AGGACGTCTGGTACGACCTTGCCAAGAAGATACATGTCAAGTGGCGCAAGAAAGACAACACCTACTCCGGCACCACGGTC
ATTCCTGATCGTGTCATGGAGCAGGCAGAAATGTACGACTTGTTCTTGAGGTTAGTTCGCGACGAGATCCAGCAGCAAAT
CATTATCTGGCACATCGCGACGGACATCTACCTCCGCACCTCCGACAAGGCAGAGACCACCGAGTATGTTGAAGCAATCA
ATCTTATTTCCAACTACATGATGTTCCTAGTTCTGGAACGTCCCTACATGAAAACACAGAGCCTTGCCAAGCAGCTGGGA
GTCACCGACCGGGACCCCAGTAAGGTCTCGCTCAATGCTCTGCCGCTTGCCCTCCTTCTAGTCAAAAAGCTCAACAAATA
CGACGGGGCCAGTGTGGAATTTCTGTTCAAGGTGTGGGTGGAGATGCTCCACTACGTTAGCCACCGATGCAGCAGGGAGT
CCCACGCCAAGCAACTCAGCAGCGGCGGCTGGCTTGTAACTCTTGTCTTGGCCAAGCTCAGCCTTGCTAGTCACATGC

BLASTn GenBank NR

Expression Profiles

Gene Chronologer
Gene Chronologer (Grouped)
Heterosis View
Gene Correlator (coexpression analysis)
SALK RiceGE
Rice MPSS MPSS logo

RiceArray Coexpression Database

Miscellaneous

SNP data between Minghui 63 and Zhenshan 97 from OryzaSNP project:

Putative homologies in rice

Putative homologies in arabidopsis