Browse Element(s) Details

OsAffx.26720.1.S1_at

Description

tigr:9633.m00305
TID=OsAffx.26720.1
CNT=1
FEA=mRNA
TIER=ConsEnd
STK=0
NOTE=sequence(s) not in UniGene
DEF=hypothetical protein
REP_ORG=O. sativa

Associated TIGR Gene Locus

TIGR Locus	Matching Probes	Description
LOC_Os05g03790	11/11	hypothetical protein
LOC_Os01g15110	1/11	Syntaxin 23, putative, expressed

Gene Context (flanking 25kb)

TIGR Locus	Matching Probeset	Matching Probes	Chr	Strand	Coordinates	Description
LOC_Os05g03760	Os.11774.1.S1_s_at	11/11	5	+	1640048..1642461	Zinc finger C-x8-C-x5-C-x3-H type family protein, expressed
LOC_Os05g03760	Os.11774.1.S1_x_at	11/11	5	+	1640048..1642461	Zinc finger C-x8-C-x5-C-x3-H type family protein, expressed
LOC_Os05g03770	Os.55734.1.S1_at	11/11	5	+	1644535..1646940	expressed protein
LOC_Os05g03780	Os.8659.1.S1_at	11/11	5	+	1653517..1657080	cation diffusion facilitator family transporter containing protein, expressed
LOC_Os05g03790	OsAffx.26720.1.S1_at	11/11	5	+	1660031..1660321	hypothetical protein
LOC_Os05g03800	OsAffx.14528.1.S1_x_at	11/11	5	+	1664890..1671989	transposon protein, putative, unclassified
LOC_Os05g03800	OsAffx.14528.1.S1_at	10/11	5	+	1664890..1671989	transposon protein, putative, unclassified
LOC_Os05g03800	OsAffx.14528.2.S1_x_at	6/11	5	+	1664890..1671989	transposon protein, putative, unclassified
LOC_Os05g03800	OsAffx.14528.3.S1_at	3/11	5	+	1664890..1671989	transposon protein, putative, unclassified
LOC_Os05g03800	OsAffx.14528.3.S1_x_at	3/11	5	+	1664890..1671989	transposon protein, putative, unclassified
LOC_Os05g03800	Os.5212.1.S1_at	1/11	5	+	1664890..1671989	transposon protein, putative, unclassified
LOC_Os05g03810	NA	NA	5	+	1673273..1675282	trehalose-phosphatase family protein
LOC_Os05g03820	Os.12568.2.S1_at	11/11	5	+	1676531..1681049	Glutamate-cysteine ligase, chloroplast precursor, putative, expressed
LOC_Os05g03820	Os.12568.1.S1_x_at	11/11	5	+	1676531..1681049	Glutamate-cysteine ligase, chloroplast precursor, putative, expressed
LOC_Os05g03820	Os.12568.1.S1_at	11/11	5	+	1676531..1681049	Glutamate-cysteine ligase, chloroplast precursor, putative, expressed
LOC_Os05g03830	OsAffx.14529.1.S1_x_at	11/11	5	+	1683019..1685087	Acetylornithine aminotransferase, mitochondrial precursor, putative, expressed
LOC_Os05g03830	Os.23217.1.S1_s_at	11/11	5	+	1683019..1685087	Acetylornithine aminotransferase, mitochondrial precursor, putative, expressed
LOC_Os05g03830	OsAffx.14529.1.S1_at	11/11	5	+	1683019..1685087	Acetylornithine aminotransferase, mitochondrial precursor, putative, expressed
LOC_Os05g03840	OsAffx.4243.1.S1_at	11/11	5	+	1685199..1687100	Glycosyl hydrolase family 9 protein

Select all/Clear all

Gene Ontology Classification

GO id	Type	Name
GO:0000903	biological_process	cellular morphogenesis during vegetative growth
GO:0006886	biological_process	intracellular protein transport
GO:0006891	biological_process	intra-Golgi vesicle-mediated transport
GO:0006896	biological_process	Golgi to vacuole transport
GO:0006944	biological_process	membrane fusion
GO:0007033	biological_process	vacuole organization and biogenesis
GO:0009660	biological_process	amyloplast organization and biogenesis
GO:0009959	biological_process	negative gravitropism
GO:0010118	biological_process	stomatal movement
GO:0005770	cellular_component	late endosome
GO:0009705	cellular_component	vacuolar membrane (sensu Magnoliophyta)
GO:0016021	cellular_component	integral to membrane
GO:0030140	cellular_component	trans-Golgi network transport vesicle
GO:0005486	molecular_function	t-SNARE activity

Probe Info

Probe Name	Hit(s)	Location	Sequence	TIGR Locus
OsAffx.26720.1.S1_at--1102--777	1	Chr05:1660064..1660088 (25 bp)	GGTCCTAAGCCGAATTTAGCCGCCT	LOC_Os05g03790
OsAffx.26720.1.S1_at--738--373	1	Chr05:1660068..1660092 (25 bp)	CTAAGCCGAATTTAGCCGCCTCCAT	LOC_Os05g03790
OsAffx.26720.1.S1_at--469--417	1	Chr05:1660084..1660108 (25 bp)	CGCCTCCATCTTGGTTCTGGAAGAA	LOC_Os05g03790
OsAffx.26720.1.S1_at--75--761	1	Chr05:1660179..1660203 (25 bp)	GGGCACAACAGGTGTCAATTGGTGA	LOC_Os05g03790
OsAffx.26720.1.S1_at--272--331	1	Chr05:1660182..1660206 (25 bp)	CACAACAGGTGTCAATTGGTGAAAT	LOC_Os05g03790
OsAffx.26720.1.S1_at--252--225	1	Chr05:1660203..1660227 (25 bp)	AAATTGCCGCATTGAGGGGTCGTTC	LOC_Os05g03790
OsAffx.26720.1.S1_at--44--771	1	Chr05:1660219..1660243 (25 bp)	GGGTCGTTCGTTGTTGCAGATATGC	LOC_Os05g03790
OsAffx.26720.1.S1_at--215--1063	2	Chr05:1660225..1660249 (25 bp)	TTCGTTGTTGCAGATATGCTTGTTG	LOC_Os05g03790
OsAffx.26720.1.S1_at--73--63	1	Chr05:1660240..1660264 (25 bp)	ATGCTTGTTGGATAGCCGCGGGACA	LOC_Os05g03790
OsAffx.26720.1.S1_at--5--31	1	Chr05:1660251..1660275 (25 bp)	ATAGCCGCGGGACACGAAGATCAGC	LOC_Os05g03790
OsAffx.26720.1.S1_at--533--281	1	Chr05:1660267..1660291 (25 bp)	AAGATCAGCGGTGTGGTCAGTGACC	LOC_Os05g03790

Target Sequence

GGTCCTAAGCCGAATTTAGCCGCCTCCATCTTGGTTCTGGAAGAAGAAGGCCGACGAAAGTGGAGTTGGGGAGTTGAGGA
GTTGGAGGTGCAGGTGGCCGGGAGGTTGGCCGGAGGGGCACAACAGGTGTCAATTGGTGAAATTGCCGCATTGAGGGGTC
GTTCGTTGTTGCAGATATGCTTGTTGGATAGCCGCGGGACACGAAGATCAGCGGTGTGGTCAGTGACC

BLASTn GenBank NR

Expression Profiles

Gene Chronologer
Gene Chronologer (Grouped)
Heterosis View
Gene Correlator (coexpression analysis)
SALK RiceGE
Rice MPSS MPSS logo

RiceArray Coexpression Database

Miscellaneous

SNP data between Minghui 63 and Zhenshan 97 from OryzaSNP project:

Putative homologies in rice

Putative homologies in arabidopsis