Os.21782.1.S1_at |
Description |
gb:AK111779.1 DB_XREF= gi:37988442 TID=Os.21782.1 CNT=4 FEA=FLmRNA TIER=FL STK=0 UG=Os.21782 (NCBI UniGene Cluster) UG_TITLE=(japonica cultivar-group) contains similarity to histone acetyltransferase GCN5 (OSJNBa0032I20.6), mRNA DEF=Oryza sativa (japonica cultivar-group) cDNA clone:J023078H10, full insert sequence. FL= gb:AK111779.1 REP_ORG=O. sativa | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Associated TIGR Gene Locus |
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Gene Context (flanking 25kb) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Gene Ontology Classification |
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Probe Info |
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Target Sequence | TCAACGAAGAACTGACATGGTCTTTGGTACATCTGATATAGTCAATTGTNGTTGTAAAATTGTTNTAGCTCTCGCCCCCC TTGTTGTGCTTTCCAGCTTTGTAGTTT | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Expression Profiles | Gene Chronologer Gene Chronologer (Grouped) Heterosis View Gene Correlator (coexpression analysis) SALK RiceGE Rice MPSS RiceArray Coexpression Database | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Miscellaneous | SNP data between Minghui 63 and Zhenshan 97 from OryzaSNP project: Putative homologies in ricePutative homologies in arabidopsis |