Os.4804.1.S1_at |
Description |
gb:AK107775.1 DB_XREF= gi:32992984 TID=Os.4804.1 CNT=5 FEA=FLmRNA TIER=FL STK=1 UG=Os.4804 (NCBI UniGene Cluster) UG_TITLE=(japonica cultivar-group) EST AU055776(S20048) corresponds to a region of the predicted gene.~Similar to Arabidopsis thaliana AP2 domain containing protein RAP2.10 mRNA, partial cds.(AF003103) (Gene), mRNA DEF=Oryza sativa (japonica cultivar-group) cDNA clone:002-133-B12, full insert sequence. FL= gb:AK107775.1 REP_ORG=O. sativa | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Associated TIGR Gene Locus |
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Gene Context (flanking 25kb) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Gene Ontology Classification |
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Probe Info |
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Target Sequence | GCAAGTAGGAATCTAGAGCTCAGCTCGTCGTCTGTTCCGGCGACGGCGACTGTACTAGGAGCGTGCGTGTCAGCGTGAGC ATGTAGCTAAAAGCAAGACGGCTATGTACCTCACCCTTTTCGCTTAAGCGTTTGTTTGTAAAGAGAAGATACCCAGCAAG CAAGACAAA | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Expression Profiles | Gene Chronologer Gene Chronologer (Grouped) Heterosis View Gene Correlator (coexpression analysis) SALK RiceGE Rice MPSS RiceArray Coexpression Database | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Miscellaneous | SNP data between Minghui 63 and Zhenshan 97 from OryzaSNP project: Putative homologies in ricePutative homologies in arabidopsis |