Browse Element(s) Details

Os.9332.2.S1_x_at

Description

gb:AK111490.1
DB_XREF= gi:37988153
TID=Os.9332.2
CNT=2
FEA=FLmRNA
TIER=FL
STK=1
UG=Os.9332 (NCBI UniGene Cluster)
UG_TITLE=(japonica cultivar-group) P0514G12.24 (P0514G12.24), mRNA
DEF=Oryza sativa (japonica cultivar-group) cDNA clone:J013000A19, full insert sequence.
FL= gb:AK111490.1
REP_ORG=O. sativa

Associated TIGR Gene Locus

TIGR Locus	Matching Probes	Description
LOC_Os06g01934	11/11	bell-like homeodomain protein 3, putative, expressed
LOC_Os10g32240	3/11	retrotransposon protein, putative, Ty3-gypsy subclass
LOC_Os02g25760	2/11	retrotransposon, putative, centromere-specific
LOC_Os09g23260	2/11	transposon protein, putative, unclassified
LOC_Os03g03034	2/11	oxidoreductase, 2OG-Fe oxygenase family protein, expressed
LOC_Os01g18500	2/11	transposon protein, putative, unclassified
LOC_Os05g43210	2/11	transposon protein, putative, unclassified
LOC_Os05g23290	2/11	retrotransposon protein, putative, Ty3-gypsy subclass
LOC_Os03g13500	1/11	transposon protein, putative, unclassified
LOC_Os11g46010	1/11	retrotransposon protein, putative, Ty1-copia subclass
LOC_Os04g37990	1/11	Sugar transporter family protein, expressed
LOC_Os05g40640	1/11	transposon protein, putative, unclassified
LOC_Os05g32560	1/11	transposon protein, putative, unclassified
LOC_Os10g42480	1/11	retrotransposon protein, putative, unclassified
LOC_Os04g27480	1/11	hypothetical protein
LOC_Os04g45440	1/11	retrotransposon protein, putative, Ty3-gypsy subclass
LOC_Os11g22580	1/11	retrotransposon protein, putative, Ty3-gypsy subclass
LOC_Os06g01510	1/11	retrotransposon protein, putative, Ty3-gypsy subclass
LOC_Os11g11140	1/11	transposon protein, putative, unclassified
LOC_Os09g29584	1/11	wall-associated kinase 3, putative, expressed
LOC_Os09g30482	1/11	transposon protein, putative, unclassified
LOC_Os09g14630	1/11	transposon protein, putative, unclassified
LOC_Os06g02820	1/11	transposon protein, putative, unclassified
LOC_Os02g04600	1/11	transposon protein, putative, unclassified

Gene Context (flanking 25kb)

TIGR Locus	Matching Probeset	Matching Probes	Chr	Strand	Coordinates	Description
LOC_Os06g01879	NA	NA	6	+	497435..498193	hypothetical protein
LOC_Os06g01890	NA	NA	6	+	501599..503591	retrotransposon protein, putative, unclassified
LOC_Os06g01899	NA	NA	6	+	504442..505200	hypothetical protein
LOC_Os06g01910	OsAffx.22610.1.S1_at	11/11	6	+	509121..510150	agamous-like MADS box protein OPMADS1, putative, expressed
LOC_Os06g01910	Os.50533.1.S1_at	1/11	6	+	509121..510150	agamous-like MADS box protein OPMADS1, putative, expressed
LOC_Os06g01920	OsAffx.22609.1.S1_x_at	11/11	6	+	510856..511805	Alpha-expansin 7 precursor, putative, expressed
LOC_Os06g01920	OsAffx.18574.1.S1_x_at	1/11	6	+	510856..511805	Alpha-expansin 7 precursor, putative, expressed
LOC_Os06g01934	Os.9332.2.S1_x_at	11/11	6	+	522061..529058	bell-like homeodomain protein 3, putative, expressed
LOC_Os06g01934	Os.9332.2.S1_at	11/11	6	+	522061..529058	bell-like homeodomain protein 3, putative, expressed
LOC_Os06g01934	Os.9332.1.S1_at	11/11	6	+	522061..529058	bell-like homeodomain protein 3, putative, expressed
LOC_Os06g01934	Os.53217.1.S1_x_at	4/11	6	+	522061..529058	bell-like homeodomain protein 3, putative, expressed
LOC_Os06g01934	Os.43567.1.S1_x_at	4/11	6	+	522061..529058	bell-like homeodomain protein 3, putative, expressed
LOC_Os06g01934	Os.38172.1.S1_x_at	3/11	6	+	522061..529058	bell-like homeodomain protein 3, putative, expressed
LOC_Os06g01950	OsAffx.22608.1.S1_at	11/11	6	+	529833..531434	phosphoglycerate mutase family protein, expressed
LOC_Os06g01960	OsAffx.22608.3.S1_x_at	11/11	6	+	532475..534605	hypothetical protein
LOC_Os06g01960	OsAffx.22608.3.S1_at	11/11	6	+	532475..534605	hypothetical protein
LOC_Os06g01960	Os.4403.1.A1_x_at	4/11	6	+	532475..534605	hypothetical protein
LOC_Os06g01966	Os.4404.1.S1_at	11/11	6	+	542058..544778	Integral membrane protein DUF6 containing protein, expressed
LOC_Os06g01966	Os.4404.1.S1_s_at	11/11	6	+	542058..544778	Integral membrane protein DUF6 containing protein, expressed
LOC_Os06g01972	Os.11580.1.S1_at	10/11	6	+	545505..549383	Integral membrane protein DUF6 containing protein, expressed
LOC_Os06g01980	Os.4407.1.S1_at	11/11	6	+	549954..554812	Cell division control protein 48 homolog C, putative, expressed
LOC_Os06g01980	Os.4407.2.S1_at	10/11	6	+	549954..554812	Cell division control protein 48 homolog C, putative, expressed

Select all/Clear all

Gene Ontology Classification

GO id	Type	Name
GO:0006468	biological_process	protein amino acid phosphorylation
GO:0007166	biological_process	cell surface receptor linked signal transduction
GO:0009058	biological_process	biosynthesis
GO:0009813	biological_process	flavonoid biosynthesis
GO:0009826	biological_process	unidimensional cell growth
GO:0015770	biological_process	sucrose transport
GO:0019748	biological_process	secondary metabolism
GO:0048527	biological_process	lateral root development
GO:0005618	cellular_component	cell wall
GO:0005634	cellular_component	nucleus
GO:0005829	cellular_component	cytosol
GO:0005886	cellular_component	plasma membrane
GO:0005887	cellular_component	integral to plasma membrane
GO:0009505	cellular_component	cell wall (sensu Magnoliophyta)
GO:0016020	cellular_component	membrane
GO:0003677	molecular_function	DNA binding
GO:0003700	molecular_function	transcription factor activity
GO:0004674	molecular_function	protein serine/threonine kinase activity
GO:0005351	molecular_function	sugar porter activity
GO:0008506	molecular_function	sucrose:hydrogen symporter activity
GO:0015144	molecular_function	carbohydrate transporter activity
GO:0015145	molecular_function	monosaccharide transporter activity
GO:0016301	molecular_function	kinase activity
GO:0016706	molecular_function	oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, 2-oxoglutarate as one donor, and incorporation of one atom each of oxygen into both donors

Probe Info

Probe Name	Hit(s)	Location	Sequence	TIGR Locus
Os.9332.2.S1_x_at--336--1003	2	Chr06:526478..526502 (25 bp)	TAGACTTTTGCGAAGGGATTGATTT	LOC_Os06g01934
Os.9332.2.S1_x_at--127--791	88	Chr12:3001127..3001151 (25 bp)	GGATTCGGGATTGAACTCGACGATA	NONE
Os.9332.2.S1_x_at--837--25	4	Chr06:526554..526578 (25 bp)	ATATGAGAAGGCACGGACACTAGAC	LOC_Os06g01934
Os.9332.2.S1_x_at--188--597	115	Chr12:16427146..16427287 (25 bp)	GAGAAGGCACGGACACTAGACAACA	NONE
Os.9332.2.S1_x_at--942--277	102	Chr12:16551994..16552018 (25 bp)	AAGAGATAGTTTTCCCGCTAGGCGC	NONE
Os.9332.2.S1_x_at--1138--545	1	Chr06:526648..526672 (25 bp)	GAACGGGCGCTACACAGGCTTTCGC	LOC_Os06g01934
Os.9332.2.S1_x_at--988--483	1	Chr06:526656..526680 (25 bp)	GCTACACAGGCTTTCGCAAACATTT	LOC_Os06g01934
Os.9332.2.S1_x_at--1049--829	1	Chr06:526664..526688 (25 bp)	GGCTTTCGCAAACATTTTGTAAGTT	LOC_Os06g01934
Os.9332.2.S1_x_at--558--553	1	Chr06:526700..526724 (25 bp)	GAAAACAACACACAAATTACTCAAA	LOC_Os06g01934
Os.9332.2.S1_x_at--578--793	1	Chr06:526784..526808 (25 bp)	GGATTTTACAACTTCTTAAATATCA	LOC_Os06g01934
Os.9332.2.S1_x_at--656--33	1	Chr06:526848..526872 (25 bp)	ATAAAGTAAGTATCCATCGTCGTGC	LOC_Os06g01934

Target Sequence

TAGACTTTTGCGAAGGGATTGATTTGGGAAGGATTTGGATTCGGGATTGAACTCGACGATAGATCGGGGATTTGAGATAT
GAGAAGGCACGGACACTAGACAACAAGCAAAGAAACAGATTTCGCAAAAAGGGTTTTTAAGAGATAGTTTTCCCGCTAGG
CGCCACGGCGGAACGGGCGCTACACAGGCTTTCGCAAACATTTTGTAAGTTAAAAAAAAAAAGAAAACAACACACAAATT
ACTCAAATTATTAATAATTAACATAAGATAGAATGCATGAACTTGTAAATATATATGTGCATAAATGGATTTTACAACTT
CTTAAATATCAATCAAACAGTTGTAAAAAGACCTAAAAATTGTAACATTGATAAAGTAAGTATCCATCGTCGTGC

BLASTn GenBank NR

Expression Profiles

Gene Chronologer
Gene Chronologer (Grouped)
Heterosis View
Gene Correlator (coexpression analysis)
SALK RiceGE
Rice MPSS MPSS logo

RiceArray Coexpression Database

Miscellaneous

SNP data between Minghui 63 and Zhenshan 97 from OryzaSNP project:

Putative homologies in rice

Putative homologies in arabidopsis