Description |
gb:NM_189142.1 DB_XREF=
gi:34905367 GEN=OJ1126_G08.13
TID=OsAffx.9790.1 CNT=1 FEA=mRNA TIER=ConsEnd STK=0 NOTE=sequence(s) not in UniGene DEF=Oryza sativa (japonica cultivar-group) OJ1126_G08.13 (OJ1126_G08.13), mRNA. REP_ORG=O. sativa |
Associated TIGR Gene Locus | TIGR Locus | Matching Probes | Description |
---|
LOC_Os01g22249 | 2/11 | Peroxidase family protein, expressed | LOC_Os07g18390 | 2/11 | retrotransposon protein, putative, unclassified | LOC_Os04g22520 | 1/11 | retrotransposon protein, putative, Ty3-gypsy subclass | LOC_Os03g21340 | 1/11 | retrotransposon protein, putative, Ty3-gypsy subclass | LOC_Os02g14700 | 1/11 | hypothetical protein | LOC_Os04g07530 | 1/11 | hypothetical protein | LOC_Os06g24640 | 1/11 | retrotransposon protein, putative, Ty3-gypsy subclass | LOC_Os04g20860 | 1/11 | retrotransposon protein, putative, unclassified | LOC_Os07g22160 | 1/11 | retrotransposon protein, putative, Ty3-gypsy subclass | LOC_Os08g11350 | 1/11 | retrotransposon protein, putative, Ty3-gypsy subclass | LOC_Os04g31890 | 1/11 | retrotransposon protein, putative, Ty3-gypsy subclass | LOC_Os03g45700 | 1/11 | retrotransposon protein, putative, unclassified | LOC_Os08g30220 | 1/11 | retrotransposon protein, putative, Ty3-gypsy subclass | LOC_Os03g45560 | 1/11 | retrotransposon protein, putative, unclassified | LOC_Os02g21740 | 1/11 | retrotransposon protein, putative, Ty3-gypsy subclass | LOC_Os05g28590 | 1/11 | retrotransposon protein, putative, unclassified |
|
Gene Context (flanking 25kb) |
|
Gene Ontology Classification | GO id | Type | Name |
---|
GO:0009269 | biological_process | response to desiccation | GO:0009409 | biological_process | response to cold | GO:0042538 | biological_process | hyperosmotic salinity response | GO:0005783 | cellular_component | endoplasmic reticulum | GO:0004601 | molecular_function | peroxidase activity |
|
Probe Info |
|
Target Sequence | GGAAACGGCGGCAACCTTCGGCTTGACGACGACGGCGGTGCTCTGGCGATCTACGGCGACGGCGGAGGGGTGGACGAGAT
CGGCGACGGCTTGGTGACCACGACGGCGACCTCCCCGAGCAGCGACGACGACTGGACCGACG BLASTn GenBank NR |
Expression Profiles | Gene Chronologer Gene Chronologer (Grouped) Heterosis View Gene Correlator (coexpression analysis) SALK RiceGE Rice MPSS RiceArray Coexpression Database |
Miscellaneous | SNP data between Minghui 63 and Zhenshan 97 from OryzaSNP project: Putative homologies in ricePutative homologies in arabidopsis |