Os.12962.1.S1_at |
Description |
gb:AU222596 DB_XREF= gi:15008208 DB_XREF=AU222596 CLONE=E20653 TID=Os.12962.1 CNT=6 FEA=EST TIER=ConsEnd STK=0 UG=Os.12962 (NCBI UniGene Cluster) UG_TITLE=Transcribed sequence with weak similarity to protein ref:NP_200854.1 (A.thaliana) protein transport protein subunit - like (Arabidopsis thaliana) REP_ORG=O. sativa | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Associated TIGR Gene Locus |
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Gene Context (flanking 25kb) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Gene Ontology Classification |
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Probe Info |
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Target Sequence | GAAGAAAGACAAACCTAAGCTTAGTGGAGTAGTAGGGATATGGATCTGCTTGCTGAGTTCTTGCTAGATCTGCCAACCAA TTGTACCCTACCCTAGTTCAACTTTACTCTTGTTTACCTTGTTTCAGACGAACA | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Expression Profiles | Gene Chronologer Gene Chronologer (Grouped) Heterosis View Gene Correlator (coexpression analysis) SALK RiceGE Rice MPSS RiceArray Coexpression Database | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Miscellaneous | SNP data between Minghui 63 and Zhenshan 97 from OryzaSNP project: Putative homologies in ricePutative homologies in arabidopsis |