Os.28988.1.S1_a_at |
Description |
gb:AK110805.1 DB_XREF= gi:32996014 TID=Os.28988.1 CNT=8 FEA=FLmRNA TIER=FL STK=1 UG=Os.28988 (NCBI UniGene Cluster) UG_TITLE=(japonica cultivar-group) simiar to ATP-binding cassette, sub-family D, member 3 (P0458E05.21), mRNA DEF=Oryza sativa (japonica cultivar-group) cDNA clone:002-171-E11, full insert sequence. FL= gb:AK110805.1 REP_ORG=O. sativa | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Associated TIGR Gene Locus |
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Gene Context (flanking 25kb) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Gene Ontology Classification |
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Probe Info |
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Target Sequence | CCACAAGTGTCGATGTTGAGGAGCATTTGTACAAGATAGCAACTAGTATGGGCATAACTGTCATCACCTCGTCACAAAGG CCTGCTCTGATACCCTTCCATTCGTTGGAGCTGAAACTCATCGATGGTGAAGGAAAGTGGGAACTATGTACAATCAACC | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Expression Profiles | Gene Chronologer Gene Chronologer (Grouped) Heterosis View Gene Correlator (coexpression analysis) SALK RiceGE Rice MPSS RiceArray Coexpression Database | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Miscellaneous | SNP data between Minghui 63 and Zhenshan 97 from OryzaSNP project: Putative homologies in ricePutative homologies in arabidopsis |