Os.9494.1.S1_s_at |
Description |
gb:CF292249 DB_XREF= gi:33661282 DB_XREF=30DGS--01-A05.g1 CLONE=30DGS--01-A05 TID=Os.9494.1 CNT=4 FEA=EST TIER=ConsEnd STK=0 UG=Os.9494 (NCBI UniGene Cluster) UG_TITLE=Transcribed sequence with weak similarity to protein pir:T47914 (A.thaliana) T47914 hypothetical protein T20K12.120 - Arabidopsis thaliana REP_ORG=O. sativa | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Associated TIGR Gene Locus |
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Gene Context (flanking 25kb) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Gene Ontology Classification |
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Probe Info |
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Target Sequence | ACGGCGAGGCCCAAGAAATTGAAGAACATGGTGCTTGATCTTGGGCCAGCGTTAGCGCAGTGAAGTTCGGGCCTGAAGCC CTGAATCCAGGTGTTGCTAAATTATGAACTTGTTCATTCTGGGAATAAGTCTA | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Expression Profiles | Gene Chronologer Gene Chronologer (Grouped) Heterosis View Gene Correlator (coexpression analysis) SALK RiceGE Rice MPSS RiceArray Coexpression Database | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Miscellaneous | SNP data between Minghui 63 and Zhenshan 97 from OryzaSNP project: Putative homologies in ricePutative homologies in arabidopsis |