Browse Element(s) Details

OsAffx.10727.1.S1_x_at

Description

gb:NM_183592.1
DB_XREF= gi:34894311
TID=OsAffx.10727.1
CNT=1
FEA=mRNA
TIER=ConsEnd
STK=0
NOTE=sequence(s) not in UniGene
DEF=Oryza sativa (japonica cultivar-group) unnamed protein product (Gene), mRNA.
REP_ORG=O. sativa

Associated TIGR Gene Locus

TIGR Locus	Matching Probes	Description
LOC_Os06g05310	1/11	Transferase family protein, expressed

Gene Context (flanking 25kb)

TIGR Locus	Matching Probeset	Matching Probes	Chr	Strand	Coordinates	Description
LOC_Os06g05240	Os.47859.1.S1_at	10/11	6	+	2357441..2364099	Zinc carboxypeptidase family protein, expressed
LOC_Os06g05250	Os.10307.1.S1_at	11/11	6	+	2365603..2371092	GTP-binding protein lepA, putative, expressed
LOC_Os06g05260	Os.53028.1.S1_at	11/11	6	+	2371993..2373947	Pectate lyase precursor, putative, expressed
LOC_Os06g05260	Os.1741.4.S1_x_at	1/11	6	+	2371993..2373947	Pectate lyase precursor, putative, expressed
LOC_Os06g05272	Os.5708.1.S1_at	9/11	6	+	2377130..2378274	Pectate lyase precursor, putative
LOC_Os06g05272	OsAffx.18481.1.S1_x_at	1/11	6	+	2377130..2378274	Pectate lyase precursor, putative
LOC_Os06g05284	Os.5951.1.S1_at	11/11	6	+	2379596..2381937	Transferase family protein, expressed
LOC_Os06g05300	OsAffx.27462.1.S1_at	11/11	6	+	2383314..2385241	Transferase family protein
LOC_Os06g05310	OsAffx.27463.1.S1_x_at	11/11	6	+	2386399..2389053	Transferase family protein, expressed
LOC_Os06g05310	OsAffx.10727.1.S1_x_at	1/11	6	+	2386399..2389053	Transferase family protein, expressed
LOC_Os06g05320	Os.54614.1.S1_at	11/11	6	+	2393822..2395563	Transferase family protein, expressed
LOC_Os06g05320	OsAffx.27463.1.S1_x_at	2/11	6	+	2393822..2395563	Transferase family protein, expressed
LOC_Os06g05330	OsAffx.28190.1.S1_at	3/11	6	+	2397357..2397813	hypothetical protein
LOC_Os06g05340	OsAffx.4729.1.S1_x_at	11/11	6	+	2398692..2401591	activator of sporamin LUC 1, putative
LOC_Os06g05340	OsAffx.4729.1.S1_at	11/11	6	+	2398692..2401591	activator of sporamin LUC 1, putative
LOC_Os06g05350	Os.8272.1.S1_s_at	11/11	6	+	2404458..2407318	DNA-binding protein p24, putative, expressed
LOC_Os06g05359	Os.50271.1.S1_at	11/11	6	+	2409177..2417569	NB-ARC domain containing protein, expressed
LOC_Os06g05359	Os.41415.1.S1_at	1/11	6	+	2409177..2417569	NB-ARC domain containing protein, expressed

Select all/Clear all

Gene Ontology Classification

GO id	Type	Name
GO:0016740	molecular_function	transferase activity

Probe Info

Probe Name	Hit(s)	Location	Sequence	TIGR Locus
OsAffx.10727.1.S1_x_at--636--937	1	Chr01:10485037..10485061 (25 bp)	TCGACGCGGCCTACTTCGGCAACTG	NONE
OsAffx.10727.1.S1_x_at--593--989	2	Chr06:2388634..2388670 (25 bp)	TACTTCGGCAACTGCGTCGCCAAGG	LOC_Os06g05310
OsAffx.10727.1.S1_x_at--296--441	1	Chr01:10485137..10485161 (25 bp)	GCCACGCGATCCAGAGGGCCGTCGG	NONE
OsAffx.10727.1.S1_x_at--354--425	1	Chr01:10485155..10485179 (25 bp)	CCGTCGGCGTTCGTGGCGTTTGCTC	NONE
OsAffx.10727.1.S1_x_at--1111--669	1	Chr01:10485163..10485187 (25 bp)	GTTCGTGGCGTTTGCTCCGGCAGCC	NONE
OsAffx.10727.1.S1_x_at--942--1027	1	Chr01:10485173..10485197 (25 bp)	TTTGCTCCGGCAGCCGAGGTTCGTG	NONE
OsAffx.10727.1.S1_x_at--388--443	1	Chr01:10485207..10485231 (25 bp)	GCCTCGCCGCGGTTTCGGGCGTACG	NONE
OsAffx.10727.1.S1_x_at--106--995	1	Chr01:10485228..10485252 (25 bp)	TACGACGCGGCGGATTTTGGGCTGG	NONE
OsAffx.10727.1.S1_x_at--894--755	1	Chr01:10485252..10485276 (25 bp)	GGGCGCGCCAAATCCCAGCCAGGTA	NONE
OsAffx.10727.1.S1_x_at--1077--451	1	Chr01:10485256..10485280 (25 bp)	GCGCCAAATCCCAGCCAGGTACGAG	NONE
OsAffx.10727.1.S1_x_at--137--329	1	Chr01:10485260..10485284 (25 bp)	CAAATCCCAGCCAGGTACGAGCTCT	NONE

Target Sequence

TCGACGCGGCCTACTTCGGCAACTGCGTCGCCAAGGCGGCGGCCGCGCGCGACCGACCTGGCCCGGCCGACCCCCGGCGC
GGCGTCCTGCATGCGCGCGCGCCACGCGATCCAGAGGGCCGTCGGCGTTCGTGGCGTTTGCTCCGGCAGCCGAGGTTCGT
GGCGGCGTCCGCCTCGCCGCGGTTTCGGGCGTACGACGCGGCGGATTTTGGGCTGGGGCGCGCCAAATCCCAGCCAGGTA
CGAGCTCT

BLASTn GenBank NR

Expression Profiles

Gene Chronologer
Gene Chronologer (Grouped)
Heterosis View
Gene Correlator (coexpression analysis)
SALK RiceGE
Rice MPSS MPSS logo

RiceArray Coexpression Database

Miscellaneous

SNP data between Minghui 63 and Zhenshan 97 from OryzaSNP project:

Putative homologies in rice

Putative homologies in arabidopsis