Browse Element(s) Details

OsAffx.21171.2.S1_at

Description

gb:NM_185101.1
DB_XREF= gi:34897287
GEN=OSJNBb0027B08.26
TID=OsAffx.21171.2
CNT=1
FEA=mRNA
TIER=ConsEnd
STK=0
NOTE=sequence(s) not in UniGene
DEF=Oryza sativa (japonica cultivar-group) putative gag-pol precursor (OSJNBb0027B08.26), mRNA.
PROD=putative gag-pol precursor
REP_ORG=O. sativa

Associated TIGR Gene Locus

TIGR Locus	Matching Probes	Description
LOC_Os03g61400	11/11	retrotransposon protein, putative, unclassified
LOC_Os07g42680	2/11	transposon protein, putative, unclassified
LOC_Os05g37750	2/11	retrotransposon protein, putative, unclassified
LOC_Os12g20300	1/11	retrotransposon protein, putative, Ty3-gypsy subclass

Gene Context (flanking 25kb)

TIGR Locus	Matching Probeset	Matching Probes	Chr	Strand	Coordinates	Description
LOC_Os03g61330	Os.30021.1.S1_at	10/11	3	+	34756059..34759297	Fumarylacetoacetate hydrolase domain containing protein 1, putative, expressed
LOC_Os03g61330	Os.30021.2.S1_at	9/11	3	+	34756059..34759297	Fumarylacetoacetate hydrolase domain containing protein 1, putative, expressed
LOC_Os03g61340	Os.25535.1.S1_at	11/11	3	+	34759621..34762463	hydrolase, alpha/beta fold family protein, expressed
LOC_Os03g61340	Os.30886.3.S1_x_at	1/11	3	+	34759621..34762463	hydrolase, alpha/beta fold family protein, expressed
LOC_Os03g61340	Os.30886.2.S1_x_at	1/11	3	+	34759621..34762463	hydrolase, alpha/beta fold family protein, expressed
LOC_Os03g61340	Os.30886.1.S1_x_at	1/11	3	+	34759621..34762463	hydrolase, alpha/beta fold family protein, expressed
LOC_Os03g61360	Os.30886.1.S1_x_at	11/11	3	+	34764436..34767878	hydrolase, alpha/beta fold family protein, expressed
LOC_Os03g61360	Os.30886.1.S1_at	11/11	3	+	34764436..34767878	hydrolase, alpha/beta fold family protein, expressed
LOC_Os03g61360	Os.30886.2.S1_at	11/11	3	+	34764436..34767878	hydrolase, alpha/beta fold family protein, expressed
LOC_Os03g61360	Os.30886.2.S1_x_at	11/11	3	+	34764436..34767878	hydrolase, alpha/beta fold family protein, expressed
LOC_Os03g61360	Os.30886.3.S1_x_at	6/11	3	+	34764436..34767878	hydrolase, alpha/beta fold family protein, expressed
LOC_Os03g61370	OsAffx.31869.1.S1_at	10/11	3	+	34770196..34771311	retrotransposon protein, putative, unclassified
LOC_Os03g61370	OsAffx.31869.5.S1_x_at	4/11	3	+	34770196..34771311	retrotransposon protein, putative, unclassified
LOC_Os03g61370	OsAffx.31869.4.S1_at	2/11	3	+	34770196..34771311	retrotransposon protein, putative, unclassified
LOC_Os03g61370	OsAffx.31869.2.S1_at	1/11	3	+	34770196..34771311	retrotransposon protein, putative, unclassified
LOC_Os03g61370	OsAffx.31869.3.S1_s_at	1/11	3	+	34770196..34771311	retrotransposon protein, putative, unclassified
LOC_Os03g61370	OsAffx.31869.4.S1_x_at	1/11	3	+	34770196..34771311	retrotransposon protein, putative, unclassified
LOC_Os03g61380	OsAffx.22711.4.S1_at	11/11	3	+	34775361..34776347	retrotransposon protein, putative, unclassified
LOC_Os03g61390	OsAffx.22711.3.S1_x_at	11/11	3	+	34779831..34782133	retrotransposon protein, putative, unclassified
LOC_Os03g61390	OsAffx.22711.3.S1_at	11/11	3	+	34779831..34782133	retrotransposon protein, putative, unclassified
LOC_Os03g61390	OsAffx.22711.1.S1_x_at	2/11	3	+	34779831..34782133	retrotransposon protein, putative, unclassified
LOC_Os03g61390	OsAffx.20380.1.S1_at	1/11	3	+	34779831..34782133	retrotransposon protein, putative, unclassified
LOC_Os03g61390	OsAffx.20380.2.S1_x_at	1/11	3	+	34779831..34782133	retrotransposon protein, putative, unclassified
LOC_Os03g61390	OsAffx.20380.1.S1_x_at	1/11	3	+	34779831..34782133	retrotransposon protein, putative, unclassified
LOC_Os03g61390	OsAffx.8420.1.S1_at	1/11	3	+	34779831..34782133	retrotransposon protein, putative, unclassified
LOC_Os03g61400	OsAffx.21171.2.S1_at	11/11	3	+	34782778..34788534	retrotransposon protein, putative, unclassified
LOC_Os03g61400	OsAffx.21171.4.S1_x_at	5/11	3	+	34782778..34788534	retrotransposon protein, putative, unclassified
LOC_Os03g61400	OsAffx.21171.3.S1_x_at	3/11	3	+	34782778..34788534	retrotransposon protein, putative, unclassified
LOC_Os03g61400	OsAffx.22692.1.A1_x_at	1/11	3	+	34782778..34788534	retrotransposon protein, putative, unclassified
LOC_Os03g61400	OsAffx.20729.1.S1_x_at	1/11	3	+	34782778..34788534	retrotransposon protein, putative, unclassified
LOC_Os03g61400	OsAffx.21171.5.S1_x_at	1/11	3	+	34782778..34788534	retrotransposon protein, putative, unclassified
LOC_Os03g61410	Os.25292.1.S1_a_at	11/11	3	+	34790477..34791484	expressed protein
LOC_Os03g61419	NA	NA	3	+	34792167..34793228	hypothetical protein
LOC_Os03g61430	OsAffx.13570.1.S1_at	11/11	3	+	34796047..34796818	Protein of unknown function, DUF614 containing protein
LOC_Os03g61430	OsAffx.22650.1.S1_x_at	3/11	3	+	34796047..34796818	Protein of unknown function, DUF614 containing protein
LOC_Os03g61440	OsAffx.25790.1.S1_at	11/11	3	+	34799694..34800356	Protein of unknown function, DUF614 containing protein
LOC_Os03g61450	NA	NA	3	+	34803207..34804235	Transposable element protein, putative, MuDR
LOC_Os03g61460	OsAffx.22940.1.S1_s_at	11/11	3	+	34804694..34805856	hypothetical protein
LOC_Os03g61460	OsAffx.22940.2.S1_at	9/11	3	+	34804694..34805856	hypothetical protein
LOC_Os03g61460	OsAffx.22940.2.S1_s_at	9/11	3	+	34804694..34805856	hypothetical protein
LOC_Os03g61460	OsAffx.22940.3.S1_x_at	8/11	3	+	34804694..34805856	hypothetical protein
LOC_Os03g61460	OsAffx.22940.5.S1_x_at	3/11	3	+	34804694..34805856	hypothetical protein
LOC_Os03g61460	OsAffx.22940.5.S1_at	2/11	3	+	34804694..34805856	hypothetical protein
LOC_Os03g61460	OsAffx.31552.2.S1_at	1/11	3	+	34804694..34805856	hypothetical protein
LOC_Os03g61470	OsAffx.22650.2.S1_x_at	11/11	3	+	34809610..34810288	expressed protein
LOC_Os03g61470	OsAffx.22650.2.S1_at	11/11	3	+	34809610..34810288	expressed protein
LOC_Os03g61470	OsAffx.22650.1.S1_x_at	2/11	3	+	34809610..34810288	expressed protein
LOC_Os03g61480	OsAffx.22650.1.S1_x_at	11/11	3	+	34812844..34813474	Protein of unknown function, DUF614 containing protein
LOC_Os03g61480	OsAffx.22650.2.S1_x_at	1/11	3	+	34812844..34813474	Protein of unknown function, DUF614 containing protein

Select all/Clear all

Gene Ontology Classification

GO id	Type	Name
NONE	NONE	NONE

Probe Info

Probe Name	Hit(s)	Location	Sequence	TIGR Locus
OsAffx.21171.2.S1_at--1133--779	1	Chr03:34783106..34783130 (25 bp)	GGTCGCCTCGTGTCGCGTTGTACAA	LOC_Os03g61400
OsAffx.21171.2.S1_at--238--419	1	Chr03:34783064..34783088 (25 bp)	CCCTTCGCCGCGAAGATCTCGATTA	LOC_Os03g61400
OsAffx.21171.2.S1_at--917--451	1	Chr03:34783058..34783082 (25 bp)	GCCGCGAAGATCTCGATTATCTTGA	LOC_Os03g61400
OsAffx.21171.2.S1_at--210--163	3	Chr07:25555434..25555458 (25 bp)	AGCGGCCTTGCGTGCCGCGCGCTAT	LOC_Os07g42680
OsAffx.21171.2.S1_at--306--757	1	Chr03:34782956..34782980 (25 bp)	GGGCCCGATCACTACAAGCTAGCGA	LOC_Os03g61400
OsAffx.21171.2.S1_at--216--645	1	Chr03:34782950..34782974 (25 bp)	GATCACTACAAGCTAGCGACCTCGT	LOC_Os03g61400
OsAffx.21171.2.S1_at--918--219	2	Chr07:25555589..25555854 (25 bp)	ACAAAGTGATCGAAGTGCCCTGGCT	NONE
OsAffx.21171.2.S1_at--400--285	1	Chr03:34782860..34782884 (25 bp)	AAGTGATCGAAGTGCCCTGGCTAGG	LOC_Os03g61400
OsAffx.21171.2.S1_at--178--529	1	Chr03:34782852..34782876 (25 bp)	GAAGTGCCCTGGCTAGGCTCCGTTC	LOC_Os03g61400
OsAffx.21171.2.S1_at--1111--369	1	Chr03:34782840..34782864 (25 bp)	CTAGGCTCCGTTCGGTTAACCATGG	LOC_Os03g61400
OsAffx.21171.2.S1_at--1019--979	4	Chr07:25555628..25555652 (25 bp)	TAACCATGGAGGACGGCACAGAGCT	LOC_Os07g42680

Target Sequence

GGTCGCCTCGTGTCGCGTTGTACAACGAGGCCAACCAAGATGCCCTTCGCCGCGAAGATCTCGATTATCTTGAAGAACGG
AGAAGGCGAGCGGCCTTGCGTGCCGCGCGCTATCAACAAAGCCTGCGACGCTACCATCAGCGCCACGTCCGGGCCCGATC
ACTACAAGCTAGCGACCTCGTCCTACGCCGCGTTCAGTCGCGCCTGGGGCTGAGGAAGCTCTCGCCAATGTGGGAAGGGC
CATACAAAGTGATCGAAGTGCCCTGGCTAGGCTCCGTTCGGTTAACCATGGAGGACGGCACAGAGCT

BLASTn GenBank NR

Expression Profiles

Gene Chronologer
Gene Chronologer (Grouped)
Heterosis View
Gene Correlator (coexpression analysis)
SALK RiceGE
Rice MPSS MPSS logo

RiceArray Coexpression Database

Miscellaneous

SNP data between Minghui 63 and Zhenshan 97 from OryzaSNP project:

Putative homologies in rice

Putative homologies in arabidopsis