Browse Element(s) Details

Os.22839.1.S1_at

Description

gb:AK120345.1
DB_XREF= gi:37989968
TID=Os.22839.1
CNT=36
FEA=FLmRNA
TIER=FL
STK=1
UG=Os.22839 (NCBI UniGene Cluster)
UG_TITLE=(japonica cultivar-group) cDNA clone:001-127-F01, full insert sequence
DEF=Oryza sativa (japonica cultivar-group) cDNA clone:J013063H05, full insert sequence.
FL= gb:AK105513.1 gb:AK120345.1
REP_ORG=O. sativa

Associated TIGR Gene Locus

TIGR Locus	Matching Probes	Description
LOC_Os06g48200	11/11	xyloglucan endotransglucosylase/hydrolase protein 15precursor, putative, expressed

Gene Context (flanking 25kb)

TIGR Locus	Matching Probeset	Matching Probes	Chr	Strand	Coordinates	Description
LOC_Os06g48160	Os.28030.1.S1_at	11/11	6	+	29132108..29133573	xyloglucan endotransglucosylase/hydrolase protein 15precursor, putative, expressed
LOC_Os06g48160	Os.28030.1.S1_s_at	11/11	6	+	29132108..29133573	xyloglucan endotransglucosylase/hydrolase protein 15precursor, putative, expressed
LOC_Os06g48160	Os.28030.2.A1_at	11/11	6	+	29132108..29133573	xyloglucan endotransglucosylase/hydrolase protein 15precursor, putative, expressed
LOC_Os06g48170	OsAffx.15981.1.S1_at	11/11	6	+	29136090..29138508	Brassinosteroid-regulated protein BRU1 precursor, putative, expressed
LOC_Os06g48180	Os.27205.1.S1_at	11/11	6	+	29143890..29145563	Brassinosteroid-regulated protein BRU1 precursor, putative, expressed
LOC_Os06g48190	OsAffx.27931.1.S1_at	11/11	6	+	29146381..29147624	expressed protein
LOC_Os06g48190	OsAffx.5700.1.S1_x_at	1/11	6	+	29146381..29147624	expressed protein
LOC_Os06g48190	OsAffx.27931.2.S1_x_at	1/11	6	+	29146381..29147624	expressed protein
LOC_Os06g48190	OsAffx.27931.2.S1_at	1/11	6	+	29146381..29147624	expressed protein
LOC_Os06g48200	Os.22839.1.S2_at	11/11	6	+	29155430..29156885	xyloglucan endotransglucosylase/hydrolase protein 15precursor, putative, expressed
LOC_Os06g48200	Os.22839.1.S1_at	11/11	6	+	29155430..29156885	xyloglucan endotransglucosylase/hydrolase protein 15precursor, putative, expressed
LOC_Os06g48210	OsAffx.28166.1.S1_at	11/11	6	+	29162810..29165835	ATP-dependent helicase DDX41, putative, expressed
LOC_Os06g48210	OsAffx.28166.1.S1_s_at	11/11	6	+	29162810..29165835	ATP-dependent helicase DDX41, putative, expressed
LOC_Os06g48220	NA	NA	6	+	29170336..29171172	hypothetical protein
LOC_Os06g48230	Os.52719.1.S1_at	11/11	6	+	29172200..29174610	RNA polymerase Rpb8 family protein, expressed
LOC_Os06g48230	Os.8227.1.A1_s_at	11/11	6	+	29172200..29174610	RNA polymerase Rpb8 family protein, expressed
LOC_Os06g48240	OsAffx.28169.2.S1_at	11/11	6	+	29179298..29180824	ATPase, AAA family protein, expressed
LOC_Os06g48240	OsAffx.25760.1.S1_x_at	1/11	6	+	29179298..29180824	ATPase, AAA family protein, expressed

Select all/Clear all

Gene Ontology Classification

GO id	Type	Name
GO:0009664	biological_process	cell wall organization and biogenesis (sensu Magnoliophyta)
GO:0009832	biological_process	cell wall biosynthesis (sensu Magnoliophyta)
GO:0005618	cellular_component	cell wall
GO:0005737	cellular_component	cytoplasm
GO:0016762	molecular_function	xyloglucan:xyloglucosyl transferase activity
GO:0016798	molecular_function	hydrolase activity, acting on glycosyl bonds

Probe Info

Probe Name	Hit(s)	Location	Sequence	TIGR Locus
Os.22839.1.S1_at--483--419	1	Chr06:29156815..29156839 (25 bp)	CCCCATTGATCAGTGAGCTAGCTAG	LOC_Os06g48200
Os.22839.1.S1_at--264--485	1	Chr06:29156799..29156823 (25 bp)	GCTAGCTAGTAGCTGGTTGGTTAAA	LOC_Os06g48200
Os.22839.1.S1_at--831--719	1	Chr06:29156716..29156740 (25 bp)	GTCGTGTTGGTTGCCATGTCGGCCA	LOC_Os06g48200
Os.22839.1.S1_at--324--839	1	Chr06:29156687..29156711 (25 bp)	GGCGACGGCCAACTTTAACCAGGAG	LOC_Os06g48200
Os.22839.1.S1_at--704--1033	1	Chr06:29156674..29156698 (25 bp)	TTTAACCAGGAGTTCGACATCACCT	LOC_Os06g48200
Os.22839.1.S1_at--348--57	1	Chr06:29156629..29156653 (25 bp)	ATCCTCGAGGATGGCCAGCTGCTGA	LOC_Os06g48200
Os.22839.1.S1_at--726--385	1	Chr06:29156608..29156632 (25 bp)	CTGACGCTCACGCTGGACAGGACGT	LOC_Os06g48200
Os.22839.1.S1_at--895--95	1	Chr06:29156590..29156614 (25 bp)	AGGACGTCCGGCTCAGGGTTCCAGT	LOC_Os06g48200
Os.22839.1.S1_at--440--105	1	Chr06:29156576..29156600 (25 bp)	AGGGTTCCAGTCCAAGCACGAGTAC	LOC_Os06g48200
Os.22839.1.S1_at--554--271	1	Chr06:29156563..29156587 (25 bp)	AAGCACGAGTACCTCTACGGCAAGA	LOC_Os06g48200
Os.22839.1.S1_at--658--841	1	Chr06:29156391..29156415 (25 bp)	GGCCGACGCATGATGAGATCGACTT	LOC_Os06g48200

Target Sequence

CCCCATTGATCAGTGAGCTAGCTAGTAGCTGGTTGGTTAAAAGGCCTTTTTGTTTTGTTTGAGTTGGAGCAGAGGAGAAG
AATGGCGGCTCTGCTTGTGGTCGTGTTGGTTGCCATGTCGGCCATGGTGGCGACGGCCAACTTTAACCAGGAGTTCGACA
TCACCTGGGGCGATGGCCGTGGCAAGATCCTCGAGGATGGCCAGCTGCTGACGCTCACGCTGGACAGGACGTCCGGCTCA
GGGTTCCAGTCCAAGCACGAGTACCTCTACGGCAAGATCGACATGCAGCTCAAGCTCGTCCCCGGCAACTCCGCCGGCAC
CGTCACCGCCTACTACTTGTCGTCGCAGGGGCCGACGCATGATGAGATCGACTT

BLASTn GenBank NR

Expression Profiles

Gene Chronologer
Gene Chronologer (Grouped)
Heterosis View
Gene Correlator (coexpression analysis)
SALK RiceGE
Rice MPSS MPSS logo

RiceArray Coexpression Database

Miscellaneous

SNP data between Minghui 63 and Zhenshan 97 from OryzaSNP project:

Putative homologies in rice

Putative homologies in arabidopsis