Browse Element(s) Details

Os.34161.1.S1_a_at

Description

gb:AK072617.1
DB_XREF= gi:32982640
TID=Os.34161.1
CNT=2
FEA=FLmRNA
TIER=FL
STK=2
UG=Os.34161 (NCBI UniGene Cluster)
UG_TITLE=(japonica cultivar-group) Similar to Arabidopsis thaliana BAC T12H20; isp4-like protein (AF080119) (Gene), mRNA
DEF=Oryza sativa (japonica cultivar-group) cDNA clone:J023127G03, full insert sequence.
FL= gb:AK072617.1
REP_ORG=O. sativa

Associated TIGR Gene Locus

TIGR Locus	Matching Probes	Description
LOC_Os06g03700	11/11	oligopeptide transporter 9, putative, expressed

Gene Context (flanking 25kb)

TIGR Locus	Matching Probeset	Matching Probes	Chr	Strand	Coordinates	Description
LOC_Os06g03670	OsAffx.27442.1.S1_at	11/11	6	+	1433743..1434837	AP2 domain containing protein, expressed
LOC_Os06g03670	Os.4463.1.S1_s_at	11/11	6	+	1433743..1434837	AP2 domain containing protein, expressed
LOC_Os06g03670	Os.57517.1.S1_x_at	1/11	6	+	1433743..1434837	AP2 domain containing protein, expressed
LOC_Os06g03676	OsAffx.27443.1.S1_at	11/11	6	+	1437382..1444140	SET domain-containing protein, putative, expressed
LOC_Os06g03676	OsAffx.27443.1.S1_x_at	11/11	6	+	1437382..1444140	SET domain-containing protein, putative, expressed
LOC_Os06g03676	Os.44812.1.S1_at	11/11	6	+	1437382..1444140	SET domain-containing protein, putative, expressed
LOC_Os06g03682	Os.4465.1.S1_a_at	11/11	6	+	1444558..1447649	Calcium-dependent protein kinase, isoform AK1, putative, expressed
LOC_Os06g03682	Os.4465.1.S1_s_at	11/11	6	+	1444558..1447649	Calcium-dependent protein kinase, isoform AK1, putative, expressed
LOC_Os06g03690	Os.5600.1.S1_s_at	11/11	6	+	1454386..1457554	RNA recognition motif family protein, expressed
LOC_Os06g03690	OsAffx.27444.1.S1_at	11/11	6	+	1454386..1457554	RNA recognition motif family protein, expressed
LOC_Os06g03700	Os.34161.2.S1_x_at	11/11	6	+	1458769..1463334	oligopeptide transporter 9, putative, expressed
LOC_Os06g03700	Os.34161.1.S1_a_at	11/11	6	+	1458769..1463334	oligopeptide transporter 9, putative, expressed
LOC_Os06g03700	Os.34161.1.S1_at	11/11	6	+	1458769..1463334	oligopeptide transporter 9, putative, expressed
LOC_Os06g03710	Os.31950.1.S1_at	11/11	6	+	1464501..1467594	GRAS family transcription factor containing protein, expressed
LOC_Os06g03720	Os.9043.1.S1_at	11/11	6	+	1469866..1471141	Ribonucleoside-diphosphate reductase small chain, putative, expressed
LOC_Os06g03740	OsAffx.27445.1.S1_at	11/11	6	+	1475240..1476237	Formimidoyltransferase-cyclodeaminase, putative, expressed
LOC_Os06g03740	OsAffx.27445.1.S1_x_at	11/11	6	+	1475240..1476237	Formimidoyltransferase-cyclodeaminase, putative, expressed
LOC_Os06g03740	OsAffx.27445.2.S1_x_at	7/11	6	+	1475240..1476237	Formimidoyltransferase-cyclodeaminase, putative, expressed
LOC_Os06g03750	Os.44810.1.S1_at	11/11	6	+	1478059..1484508	dehydration-responsive family protein, putative, expressed
LOC_Os06g03750	Os.52574.2.S1_x_at	1/11	6	+	1478059..1484508	dehydration-responsive family protein, putative, expressed
LOC_Os06g03760	Os.4272.1.S1_a_at	11/11	6	+	1484975..1489635	LMBR1 integral membrane family protein, putative, expressed

Select all/Clear all

Gene Ontology Classification

GO id	Type	Name
GO:0006857	biological_process	oligopeptide transport
GO:0016020	cellular_component	membrane
GO:0015198	molecular_function	oligopeptide transporter activity

Probe Info

Probe Name	Hit(s)	Location	Sequence	TIGR Locus
Os.34161.1.S1_a_at--803--783	2	Chr06:1462738..1462762 (25 bp)	GGTAATGATTTGGATGGTTGTCCAT	LOC_Os06g03700
Os.34161.1.S1_a_at--491--625	1	Chr06:1462750..1462774 (25 bp)	GATGGTTGTCCATTAGCTTCTTGCC	LOC_Os06g03700
Os.34161.1.S1_a_at--341--83	1	Chr06:1462751..1462775 (25 bp)	ATGGTTGTCCATTAGCTTCTTGCCC	LOC_Os06g03700
Os.34161.1.S1_a_at--926--791	1	Chr06:1462753..1462777 (25 bp)	GGTTGTCCATTAGCTTCTTGCCCCA	LOC_Os06g03700
Os.34161.1.S1_a_at--414--871	1	Chr06:1462756..1462780 (25 bp)	TGTCCATTAGCTTCTTGCCCCATTG	LOC_Os06g03700
Os.34161.1.S1_a_at--915--155	1	Chr06:1462764..1462788 (25 bp)	AGCTTCTTGCCCCATTGCGGAAGGT	LOC_Os06g03700
Os.34161.1.S1_a_at--576--1055	1	Chr06:1462767..1462791 (25 bp)	TTCTTGCCCCATTGCGGAAGGTATA	LOC_Os06g03700
Os.34161.1.S1_a_at--720--957	1	Chr06:1462768..1462792 (25 bp)	TCTTGCCCCATTGCGGAAGGTATAA	LOC_Os06g03700
Os.34161.1.S1_a_at--206--917	1	Chr06:1462771..1462795 (25 bp)	TGCCCCATTGCGGAAGGTATAACTG	LOC_Os06g03700
Os.34161.1.S1_a_at--576--417	1	Chr06:1462774..1462798 (25 bp)	CCCATTGCGGAAGGTATAACTGTAC	LOC_Os06g03700
Os.34161.1.S1_a_at--545--1069	1	Chr06:1462778..1462802 (25 bp)	TTGCGGAAGGTATAACTGTACAGGG	LOC_Os06g03700

Target Sequence

GGTAATGATTTGGATGGTTGTCCATTAGCTTCTTGCCCCATTGCGGAAGGTATAACTGTACAGGG

BLASTn GenBank NR

Expression Profiles

Gene Chronologer
Gene Chronologer (Grouped)
Heterosis View
Gene Correlator (coexpression analysis)
SALK RiceGE
Rice MPSS MPSS logo

RiceArray Coexpression Database

Miscellaneous

SNP data between Minghui 63 and Zhenshan 97 from OryzaSNP project:

Putative homologies in rice

Putative homologies in arabidopsis