Browse Element(s) Details

Os.4463.1.S1_s_at

Description

gb:AY327040.1
DB_XREF= gi:32966056
TID=Os.4463.1
CNT=1
FEA=FLmRNA
TIER=FL
STK=1
UG=Os.4463 (NCBI UniGene Cluster)
DEF=Oryza sativa (japonica cultivar-group) transcription factor CBF1 mRNA, complete cds.
PROD=transcription factor CBF1
FL= gb:AY327040.1
REP_ORG=O. sativa

Associated TIGR Gene Locus

TIGR Locus	Matching Probes	Description
LOC_Os06g03670	11/11	AP2 domain containing protein, expressed

Gene Context (flanking 25kb)

TIGR Locus	Matching Probeset	Matching Probes	Chr	Strand	Coordinates	Description
LOC_Os06g03640	Os.10179.1.S1_at	11/11	6	+	1413222..1415364	BAG domain-containing protein, putative, expressed
LOC_Os06g03650	NA	NA	6	+	1420577..1420819	expressed protein
LOC_Os06g03660	Os.4462.1.S1_a_at	11/11	6	+	1422798..1426674	Peroxisomal membrane protein PEX11-1, putative, expressed
LOC_Os06g03670	OsAffx.27442.1.S1_at	11/11	6	+	1433743..1434837	AP2 domain containing protein, expressed
LOC_Os06g03670	Os.4463.1.S1_s_at	11/11	6	+	1433743..1434837	AP2 domain containing protein, expressed
LOC_Os06g03670	Os.57517.1.S1_x_at	1/11	6	+	1433743..1434837	AP2 domain containing protein, expressed
LOC_Os06g03676	OsAffx.27443.1.S1_at	11/11	6	+	1437382..1444140	SET domain-containing protein, putative, expressed
LOC_Os06g03676	OsAffx.27443.1.S1_x_at	11/11	6	+	1437382..1444140	SET domain-containing protein, putative, expressed
LOC_Os06g03676	Os.44812.1.S1_at	11/11	6	+	1437382..1444140	SET domain-containing protein, putative, expressed
LOC_Os06g03682	Os.4465.1.S1_a_at	11/11	6	+	1444558..1447649	Calcium-dependent protein kinase, isoform AK1, putative, expressed
LOC_Os06g03682	Os.4465.1.S1_s_at	11/11	6	+	1444558..1447649	Calcium-dependent protein kinase, isoform AK1, putative, expressed
LOC_Os06g03690	Os.5600.1.S1_s_at	11/11	6	+	1454386..1457554	RNA recognition motif family protein, expressed
LOC_Os06g03690	OsAffx.27444.1.S1_at	11/11	6	+	1454386..1457554	RNA recognition motif family protein, expressed
LOC_Os06g03700	Os.34161.2.S1_x_at	11/11	6	+	1458769..1463334	oligopeptide transporter 9, putative, expressed
LOC_Os06g03700	Os.34161.1.S1_a_at	11/11	6	+	1458769..1463334	oligopeptide transporter 9, putative, expressed
LOC_Os06g03700	Os.34161.1.S1_at	11/11	6	+	1458769..1463334	oligopeptide transporter 9, putative, expressed

Select all/Clear all

Gene Ontology Classification

GO id	Type	Name
GO:0006355	biological_process	regulation of transcription, DNA-dependent
GO:0009409	biological_process	response to cold
GO:0009414	biological_process	response to water deprivation
GO:0009631	biological_process	cold acclimation
GO:0009686	biological_process	gibberellic acid biosynthesis
GO:0016049	biological_process	cell growth
GO:0048510	biological_process	regulation of timing of transition from vegetative to reproductive phase
GO:0005634	cellular_component	nucleus
GO:0003677	molecular_function	DNA binding
GO:0003700	molecular_function	transcription factor activity
GO:0016563	molecular_function	transcriptional activator activity

Probe Info

Probe Name	Hit(s)	Location	Sequence	TIGR Locus
Os.4463.1.S1_s_at--315--763	1	Chr06:1433949..1433973 (25 bp)	GGGAGCCCAACAAGAAGTCCCGCAT	LOC_Os06g03670
Os.4463.1.S1_s_at--855--421	2	Chr06:1434225..1434249 (25 bp)	CCGCGCCCGCCATGATGATGCAGTA	LOC_Os06g03670
Os.4463.1.S1_s_at--28--71	1	Chr06:1434236..1434260 (25 bp)	ATGATGATGCAGTACCAGGACGACA	LOC_Os06g03670
Os.4463.1.S1_s_at--1105--993	1	Chr06:1434281..1434305 (25 bp)	TACGACTACGCGTACTACGGCAACA	LOC_Os06g03670
Os.4463.1.S1_s_at--984--991	1	Chr06:1434296..1434320 (25 bp)	TACGGCAACATGGACTTCGACCAGC	LOC_Os06g03670
Os.4463.1.S1_s_at--963--725	1	Chr06:1434322..1434346 (25 bp)	GTCCTACTACTACGACGGGATGGGC	LOC_Os06g03670
Os.4463.1.S1_s_at--1105--469	1	Chr06:1434414..1434438 (25 bp)	GCGGCGACGTCACACTCTGGAGCTA	LOC_Os06g03670
Os.4463.1.S1_s_at--457--199	1	Chr06:1434427..1434451 (25 bp)	ACTCTGGAGCTACTGATGATCGCGA	LOC_Os06g03670
Os.4463.1.S1_s_at--227--387	1	Chr06:1434439..1434463 (25 bp)	CTGATGATCGCGAGTTGGAGCTAGC	LOC_Os06g03670
Os.4463.1.S1_s_at--267--157	1	Chr06:1434457..1434481 (25 bp)	AGCTAGCAGTTTTGAGCTCAACCAG	LOC_Os06g03670
Os.4463.1.S1_s_at--1016--367	1	Chr06:1434482..1434506 (25 bp)	CTTTGCTCCTCCTATACAGCTAAAT	LOC_Os06g03670

Target Sequence

GGGAGCCCAACAAGAAGTCCCGCATCTGGCTCGGCACCTTCGCCACCGCCGAGGCCGCCGCGCGCGCCCACGACGTCGCC
GCGCTCGCCCTCCGCGGCCGCGGCGCGTGCCTCAACTTCGCCGACTCGGCCCGCCTCCTCCGCGTCGACCCGGCCACCCT
CGCCACCCCCGACGACATCCGCCGCGCCGCCATCGAGCTCGCCGAGTCATGCCCGCACGACGCCGCCGCCGCCGCCGCCT
CCAGCTCCGCCGCCGCCGTCGAGGCCTCCGCCGCCGCCGCGCCCGCCATGATGATGCAGTACCAGGACGACATGGCGGCG
ACGCCGTCCAGCTACGACTACGCGTACTACGGCAACATGGACTTCGACCAGCCGTCCTACTACTACGACGGGATGGGCGG
CGGCGGCGAGTACCAGAGCTGGCAGATGGACGGCGACGACGATGGTGGCGCCGGCGGCTACGGCGGCGGCGACGTCACAC
TCTGGAGCTACTGATGATCGCGAGTTGGAGCTAGCAGTTTTGAGCTCAACCAGCTTTGCTCCTCCTATACAGCTAAAT

BLASTn GenBank NR

Expression Profiles

Gene Chronologer
Gene Chronologer (Grouped)
Heterosis View
Gene Correlator (coexpression analysis)
SALK RiceGE
Rice MPSS MPSS logo

RiceArray Coexpression Database

Miscellaneous

SNP data between Minghui 63 and Zhenshan 97 from OryzaSNP project:

Putative homologies in rice

Putative homologies in arabidopsis