Os.39828.1.A1_s_at |
Description |
gb:CF317944 DB_XREF= gi:33689705 DB_XREF=HD--07-N05.b1 CLONE=HD--07-N05 TID=Os.39828.1 CNT=2 FEA=EST TIER=ConsEnd STK=2 UG=Os.39828 (NCBI UniGene Cluster) UG_TITLE=Transcribed sequence with weak similarity to protein pir:T50795 (A.thaliana) T50795 hypothetical protein T30N20_130 - Arabidopsis thaliana REP_ORG=O. sativa | ||||||||||||||||||||||||||||||||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Associated TIGR Gene Locus |
| ||||||||||||||||||||||||||||||||||||||||||||||||||
Gene Context (flanking 25kb) | |||||||||||||||||||||||||||||||||||||||||||||||||||
Gene Ontology Classification |
| ||||||||||||||||||||||||||||||||||||||||||||||||||
Probe Info |
| ||||||||||||||||||||||||||||||||||||||||||||||||||
Target Sequence | GACGTTGGTCACTCGCTCCTGCCATTGAGGCTGNGCCTGTTTGAAAAAAACTCCCTTTTCCAAATAACGCTCGCTCGGGA TGATGACG | ||||||||||||||||||||||||||||||||||||||||||||||||||
Expression Profiles | Gene Chronologer Gene Chronologer (Grouped) Heterosis View Gene Correlator (coexpression analysis) SALK RiceGE Rice MPSS RiceArray Coexpression Database | ||||||||||||||||||||||||||||||||||||||||||||||||||
Miscellaneous | SNP data between Minghui 63 and Zhenshan 97 from OryzaSNP project: Putative homologies in ricePutative homologies in arabidopsis |