| Os.5156.1.S1_s_at |
| Description |
gb:AU173894 DB_XREF= gi:13165097 DB_XREF=AU173894 CLONE=S20572 TID=Os.5156.1 CNT=1 FEA=EST TIER=ConsEnd STK=1 UG=Os.5156 (NCBI UniGene Cluster) UG_TITLE=Transcribed sequence with weak similarity to protein ref:NP_565702.1 (A.thaliana) putative C3HC4 zinc finger protein (Arabidopsis thaliana) REP_ORG=O. sativa | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Associated TIGR Gene Locus |
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Gene Context (flanking 25kb) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Gene Ontology Classification |
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Probe Info |
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Target Sequence | GAAACTACCGATTCATCAGCTCATATCATGTTCATCCGTCAGTCAGACTAGGGT | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Expression Profiles | Gene Chronologer Gene Chronologer (Grouped) Heterosis View Gene Correlator (coexpression analysis) SALK RiceGE Rice MPSS RiceArray Coexpression Database | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Miscellaneous | SNP data between Minghui 63 and Zhenshan 97 from OryzaSNP project: Putative homologies in ricePutative homologies in arabidopsis |