Browse Element(s) Details

Os.5843.1.S1_at

Description

gb:AK070917.1
DB_XREF= gi:32980940
TID=Os.5843.1
CNT=14
FEA=FLmRNA
TIER=FL
STK=1
UG=Os.5843 (NCBI UniGene Cluster)
UG_TITLE=(japonica cultivar-group) cDNA clone:001-206-A02, full insert sequence
DEF=Oryza sativa (japonica cultivar-group) cDNA clone:J023065P13, full insert sequence.
FL= gb:AK070917.1 gb:AK106002.1 gb:AK061308.1
REP_ORG=O. sativa

Associated TIGR Gene Locus

TIGR Locus	Matching Probes	Description
LOC_Os06g46799	11/11	Peroxidase 3 precursor, putative, expressed

Gene Context (flanking 25kb)

TIGR Locus	Matching Probeset	Matching Probes	Chr	Strand	Coordinates	Description
LOC_Os06g46740	Os.55380.1.S1_at	11/11	6	+	28387377..28388576	Plastocyanin-like domain containing protein, expressed
LOC_Os06g46754	Os.50821.1.S1_at	10/11	6	+	28389335..28395009	p21-rho-binding domain-containing protein, putative, expressed
LOC_Os06g46754	Os.57130.1.S1_at	10/11	6	+	28389335..28395009	p21-rho-binding domain-containing protein, putative, expressed
LOC_Os06g46754	OsAffx.28139.1.S1_at	3/11	6	+	28389335..28395009	p21-rho-binding domain-containing protein, putative, expressed
LOC_Os06g46770	Os.10139.1.S1_s_at	11/11	6	+	28400733..28403579	polyubiquitin containing 7 ubiquitin monomers, putative, expressed
LOC_Os06g46770	Os.57479.1.S1_x_at	3/11	6	+	28400733..28403579	polyubiquitin containing 7 ubiquitin monomers, putative, expressed
LOC_Os06g46770	Os.25748.1.S1_x_at	1/11	6	+	28400733..28403579	polyubiquitin containing 7 ubiquitin monomers, putative, expressed
LOC_Os06g46780	OsAffx.15958.1.S1_at	9/11	6	+	28405288..28406220	Protease inhibitor/seed storage/LTP family protein
LOC_Os06g46799	Os.53303.1.S1_at	11/11	6	+	28413036..28424516	Peroxidase 3 precursor, putative, expressed
LOC_Os06g46799	Os.5843.1.S1_at	11/11	6	+	28413036..28424516	Peroxidase 3 precursor, putative, expressed
LOC_Os06g46799	Os.23700.1.A1_at	1/11	6	+	28413036..28424516	Peroxidase 3 precursor, putative, expressed
LOC_Os06g46820	Os.17675.1.S1_at	11/11	6	+	28425962..28429243	expressed protein
LOC_Os06g46830	OsAffx.28140.1.S1_at	11/11	6	+	28429780..28430406	hypothetical protein
LOC_Os06g46840	OsAffx.30517.1.S1_at	3/11	6	+	28432908..28433447	pentatricopeptide, putative
LOC_Os06g46840	Os.44826.1.S1_at	1/11	6	+	28432908..28433447	pentatricopeptide, putative
LOC_Os06g46850	OsAffx.25502.2.S1_at	4/11	6	+	28433792..28435210	retrotransposon protein, putative, unclassified
LOC_Os06g46850	Os.47130.4.A1_x_at	1/11	6	+	28433792..28435210	retrotransposon protein, putative, unclassified
LOC_Os06g46860	OsAffx.28141.1.S1_at	10/11	6	+	28439984..28443176	hypothetical protein
LOC_Os06g46860	OsAffx.988.1.S1_at	1/11	6	+	28439984..28443176	hypothetical protein
LOC_Os06g46870	OsAffx.15958.1.S1_at	11/11	6	+	28447781..28448967	Protease inhibitor/seed storage/LTP family protein

Select all/Clear all

Gene Ontology Classification

GO id	Type	Name
GO:0009269	biological_process	response to desiccation
GO:0009409	biological_process	response to cold
GO:0042538	biological_process	hyperosmotic salinity response
GO:0005634	cellular_component	nucleus
GO:0005737	cellular_component	cytoplasm
GO:0005783	cellular_component	endoplasmic reticulum
GO:0004601	molecular_function	peroxidase activity
GO:0016757	molecular_function	transferase activity, transferring glycosyl groups

Probe Info

Probe Name	Hit(s)	Location	Sequence	TIGR Locus
Os.5843.1.S1_at--863--717	1	Chr06:28423940..28423964 (25 bp)	GTCGGACAACACGACGATCGTGGAG	LOC_Os06g46799
Os.5843.1.S1_at--497--439	1	Chr06:28424076..28424100 (25 bp)	GCCAACATCGCCAGCGTGGTGTCCA	LOC_Os06g46799
Os.5843.1.S1_at--1019--643	1	Chr06:28424186..28424210 (25 bp)	GATCAGGAAGCACTGCGCCCTCGTC	LOC_Os06g46799
Os.5843.1.S1_at--1054--707	1	Chr06:28424208..28424232 (25 bp)	GTCAACGACATCCACTACTAGTATT	LOC_Os06g46799
Os.5843.1.S1_at--13--689	1	Chr06:28424228..28424252 (25 bp)	GTATTATCACTAGCTCATCGATCTT	LOC_Os06g46799
Os.5843.1.S1_at--261--39	1	Chr06:28424233..28424257 (25 bp)	ATCACTAGCTCATCGATCTTCAGCT	LOC_Os06g46799
Os.5843.1.S1_at--101--33	1	Chr06:28424293..28424317 (25 bp)	ATACATGTAACTTAATTCGATCGTC	LOC_Os06g46799
Os.5843.1.S1_at--1038--315	1	Chr06:28424306..28424330 (25 bp)	AATTCGATCGTCATCCTGTTTATTC	LOC_Os06g46799
Os.5843.1.S1_at--983--951	1	Chr06:28424333..28424357 (25 bp)	TCTCTCTATGTAATTTTGTTTCCAA	LOC_Os06g46799
Os.5843.1.S1_at--934--387	1	Chr06:28424365..28424389 (25 bp)	CTGTTTTATTTTGGAGCAACTGTAA	LOC_Os06g46799
Os.5843.1.S1_at--405--807	1	Chr06:28424377..28424401 (25 bp)	GGAGCAACTGTAACTATTTCTGTAT	LOC_Os06g46799

Target Sequence

GTCGGACAACACGACGATCGTGGAGATGGACCCGGGCAGCTTCCTCACCTTCGACCTGGGCTACTACCGCGGCCTCCTCA
GGCGCCGCGGNCTCTTCCAGTCCGACGCCGCCCTCGTCACCGACGCCGCCGCGGAGGCCAACATCGCCAGCGTGGTGTCC
AGCCCGCCGGAGGTGTTCTTCCAGGTGTTCGCGAGGTCCATGGCGAAGCTGGGCATGGTCGGCGTCAAGACCGGCTCCGA
GGGCGAGATCAGGAAGCACTGCGCCCTCGTCAACGACATCCACTACTAGTATTATCACTAGCTCATCGATCTTCAGCTCC
TCGGTGCTTGATAAAATTTCAGTAGAAATATATATACATGTAACTTAATTCGATCGTCATCCTGTTTATTCTCTCTCTCT
ATGTAATTTTGTTTCCAAATTGTAACTGTTTTATTTTGGAGCAACTGTAACTATTTCTGTAT

BLASTn GenBank NR

Expression Profiles

Gene Chronologer
Gene Chronologer (Grouped)
Heterosis View
Gene Correlator (coexpression analysis)
SALK RiceGE
Rice MPSS MPSS logo

RiceArray Coexpression Database

Miscellaneous

SNP data between Minghui 63 and Zhenshan 97 from OryzaSNP project:

Putative homologies in rice

Putative homologies in arabidopsis