Browse Element(s) Details

OsAffx.22569.2.S1_at

Description

tigr:9634.m00726
TID=OsAffx.22569.2
CNT=2
FEA=mRNA
TIER=ConsEnd
STK=0
NOTE=sequence(s) not in UniGene
DEF=oxidoreductase, 2OG-Fe(II) oxygenase family, putative
REP_ORG=O. sativa

Associated TIGR Gene Locus

TIGR Locus	Matching Probes	Description
LOC_Os06g07914	11/11	oxidoreductase, 2OG-Fe oxygenase family protein
LOC_Os06g08014	11/11	oxidoreductase, 2OG-Fe oxygenase family protein

Gene Context (flanking 25kb)

TIGR Locus	Matching Probeset	Matching Probes	Chr	Strand	Coordinates	Description
LOC_Os06g07860	Os.3545.1.S1_at	11/11	6	+	3822022..3826345	Cystathionine beta-lyase, chloroplast precursor, putative, expressed
LOC_Os06g07869	OsAffx.27501.1.S1_at	9/11	6	+	3827205..3828962	hypothetical protein
LOC_Os06g07878	Os.4216.1.S1_at	11/11	6	+	3831013..3832095	Proteasome subunit alpha type 4, putative, expressed
LOC_Os06g07878	Os.4216.1.S1_a_at	11/11	6	+	3831013..3832095	Proteasome subunit alpha type 4, putative, expressed
LOC_Os06g07878	Os.4216.2.S1_x_at	6/11	6	+	3831013..3832095	Proteasome subunit alpha type 4, putative, expressed
LOC_Os06g07887	OsAffx.27499.3.S1_x_at	11/11	6	+	3833300..3835514	Exostosin family protein
LOC_Os06g07887	OsAffx.13617.1.S1_x_at	2/11	6	+	3833300..3835514	Exostosin family protein
LOC_Os06g07887	Os.51833.1.S1_x_at	1/11	6	+	3833300..3835514	Exostosin family protein
LOC_Os06g07896	OsAffx.27499.2.S1_at	11/11	6	+	3836429..3839148	ribosomal protein S15 containing protein
LOC_Os06g07905	Os.4754.1.S1_at	11/11	6	+	3839733..3843897	galactosyltransferase family protein, putative, expressed
LOC_Os06g07914	OsAffx.22569.2.S1_at	11/11	6	+	3845137..3846812	oxidoreductase, 2OG-Fe oxygenase family protein
LOC_Os06g07914	OsAffx.22569.2.S1_x_at	11/11	6	+	3845137..3846812	oxidoreductase, 2OG-Fe oxygenase family protein
LOC_Os06g07914	OsAffx.22569.1.S1_x_at	7/11	6	+	3845137..3846812	oxidoreductase, 2OG-Fe oxygenase family protein
LOC_Os06g07923	Os.27542.1.A1_at	11/11	6	+	3851140..3853472	expressed protein
LOC_Os06g07923	Os.20904.1.S1_at	8/11	6	+	3851140..3853472	expressed protein
LOC_Os06g07923	OsAffx.19206.1.S1_x_at	2/11	6	+	3851140..3853472	expressed protein
LOC_Os06g07932	Os.15663.1.S1_at	5/11	6	+	3853649..3856371	oxidoreductase, 2OG-Fe oxygenase family protein, expressed
LOC_Os06g07932	Os.10521.1.S1_at	2/11	6	+	3853649..3856371	oxidoreductase, 2OG-Fe oxygenase family protein, expressed
LOC_Os06g07941	Os.27693.1.S1_at	11/11	6	+	3857435..3859726	iron/ascorbate-dependent oxidoreductase, putative, expressed
LOC_Os06g07941	OsAffx.22569.1.S1_x_at	1/11	6	+	3857435..3859726	iron/ascorbate-dependent oxidoreductase, putative, expressed
LOC_Os06g07960	Os.3545.1.S1_at	11/11	6	+	3860286..3864403	Cystathionine beta-lyase, chloroplast precursor, putative, expressed
LOC_Os06g07969	Os.3546.1.S1_at	11/11	6	+	3865261..3867200	expressed protein
LOC_Os06g07969	OsAffx.27501.1.S1_at	9/11	6	+	3865261..3867200	expressed protein
LOC_Os06g07978	Os.4216.1.S1_a_at	11/11	6	+	3869165..3869917	Proteasome subunit alpha type 4, putative
LOC_Os06g07978	Os.4216.2.S1_x_at	6/11	6	+	3869165..3869917	Proteasome subunit alpha type 4, putative
LOC_Os06g07978	Os.4216.1.S1_at	1/11	6	+	3869165..3869917	Proteasome subunit alpha type 4, putative
LOC_Os06g07987	OsAffx.27499.3.S1_x_at	11/11	6	+	3871356..3873570	Exostosin family protein
LOC_Os06g07987	OsAffx.13617.1.S1_x_at	2/11	6	+	3871356..3873570	Exostosin family protein
LOC_Os06g07987	Os.51833.1.S1_x_at	1/11	6	+	3871356..3873570	Exostosin family protein

Select all/Clear all

Gene Ontology Classification

GO id	Type	Name
GO:0008152	biological_process	metabolism
GO:0009813	biological_process	flavonoid biosynthesis
GO:0016491	molecular_function	oxidoreductase activity
GO:0016706	molecular_function	oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, 2-oxoglutarate as one donor, and incorporation of one atom each of oxygen into both donors

Probe Info

Probe Name	Hit(s)	Location	Sequence	TIGR Locus
OsAffx.22569.2.S1_at--411--877	2	Chr06:3884693..3884717 (25 bp)	TGTTTGCATTGCTTGGTGTTGCAGA	LOC_Os06g08014
OsAffx.22569.2.S1_at--614--1027	2	Chr06:3884695..3884719 (25 bp)	TTTGCATTGCTTGGTGTTGCAGATC	LOC_Os06g08014
OsAffx.22569.2.S1_at--685--1073	2	Chr06:3884696..3884720 (25 bp)	TTGCATTGCTTGGTGTTGCAGATCA	LOC_Os06g08014
OsAffx.22569.2.S1_at--387--907	2	Chr06:3884697..3884721 (25 bp)	TGCATTGCTTGGTGTTGCAGATCAT	LOC_Os06g08014
OsAffx.22569.2.S1_at--74--495	2	Chr06:3884698..3884722 (25 bp)	GCATTGCTTGGTGTTGCAGATCATG	LOC_Os06g08014
OsAffx.22569.2.S1_at--593--359	2	Chr06:3884699..3884723 (25 bp)	CATTGCTTGGTGTTGCAGATCATGA	LOC_Os06g08014
OsAffx.22569.2.S1_at--344--1073	2	Chr06:3884701..3884725 (25 bp)	TTGCTTGGTGTTGCAGATCATGAGC	LOC_Os06g08014
OsAffx.22569.2.S1_at--398--493	2	Chr06:3884703..3884727 (25 bp)	GCTTGGTGTTGCAGATCATGAGCAA	LOC_Os06g08014
OsAffx.22569.2.S1_at--916--1083	2	Chr06:3884705..3884729 (25 bp)	TTGGTGTTGCAGATCATGAGCAAGT	LOC_Os06g08014
OsAffx.22569.2.S1_at--671--741	2	Chr06:3884708..3884732 (25 bp)	GTGTTGCAGATCATGAGCAAGTGTT	LOC_Os06g08014
OsAffx.22569.2.S1_at--68--1073	2	Chr06:3884711..3884735 (25 bp)	TTGCAGATCATGAGCAAGTGTTCAT	LOC_Os06g08014

Target Sequence

TGTTTGCATTGCTTGGTGTTGCAGATCATGAGCAAGTGTTCAT

BLASTn GenBank NR

Expression Profiles

Gene Chronologer
Gene Chronologer (Grouped)
Heterosis View
Gene Correlator (coexpression analysis)
SALK RiceGE
Rice MPSS MPSS logo

RiceArray Coexpression Database

Miscellaneous

SNP data between Minghui 63 and Zhenshan 97 from OryzaSNP project:

Putative homologies in rice

Putative homologies in arabidopsis