Browse Element(s) Details

OsAffx.27499.2.S1_at

Description

tigr:9634.m00724
TID=OsAffx.27499.2
CNT=2
FEA=mRNA
TIER=ConsEnd
STK=0
NOTE=sequence(s) not in UniGene
DEF=ribosomal protein S15, putative
REP_ORG=O. sativa

Associated TIGR Gene Locus

TIGR Locus	Matching Probes	Description
LOC_Os06g07996	11/11	ribosomal protein S15 containing protein
LOC_Os06g07896	11/11	ribosomal protein S15 containing protein

Gene Context (flanking 25kb)

TIGR Locus	Matching Probeset	Matching Probes	Chr	Strand	Coordinates	Description
LOC_Os06g07923	Os.27542.1.A1_at	11/11	6	+	3851140..3853472	expressed protein
LOC_Os06g07923	Os.20904.1.S1_at	8/11	6	+	3851140..3853472	expressed protein
LOC_Os06g07923	OsAffx.19206.1.S1_x_at	2/11	6	+	3851140..3853472	expressed protein
LOC_Os06g07932	Os.15663.1.S1_at	5/11	6	+	3853649..3856371	oxidoreductase, 2OG-Fe oxygenase family protein, expressed
LOC_Os06g07932	Os.10521.1.S1_at	2/11	6	+	3853649..3856371	oxidoreductase, 2OG-Fe oxygenase family protein, expressed
LOC_Os06g07941	Os.27693.1.S1_at	11/11	6	+	3857435..3859726	iron/ascorbate-dependent oxidoreductase, putative, expressed
LOC_Os06g07941	OsAffx.22569.1.S1_x_at	1/11	6	+	3857435..3859726	iron/ascorbate-dependent oxidoreductase, putative, expressed
LOC_Os06g07960	Os.3545.1.S1_at	11/11	6	+	3860286..3864403	Cystathionine beta-lyase, chloroplast precursor, putative, expressed
LOC_Os06g07969	Os.3546.1.S1_at	11/11	6	+	3865261..3867200	expressed protein
LOC_Os06g07969	OsAffx.27501.1.S1_at	9/11	6	+	3865261..3867200	expressed protein
LOC_Os06g07978	Os.4216.1.S1_a_at	11/11	6	+	3869165..3869917	Proteasome subunit alpha type 4, putative
LOC_Os06g07978	Os.4216.2.S1_x_at	6/11	6	+	3869165..3869917	Proteasome subunit alpha type 4, putative
LOC_Os06g07978	Os.4216.1.S1_at	1/11	6	+	3869165..3869917	Proteasome subunit alpha type 4, putative
LOC_Os06g07987	OsAffx.27499.3.S1_x_at	11/11	6	+	3871356..3873570	Exostosin family protein
LOC_Os06g07987	OsAffx.13617.1.S1_x_at	2/11	6	+	3871356..3873570	Exostosin family protein
LOC_Os06g07987	Os.51833.1.S1_x_at	1/11	6	+	3871356..3873570	Exostosin family protein
LOC_Os06g07996	OsAffx.27499.2.S1_at	11/11	6	+	3874485..3877204	ribosomal protein S15 containing protein
LOC_Os06g08005	Os.4754.1.S1_at	11/11	6	+	3877872..3882078	galactosyltransferase family protein, putative, expressed
LOC_Os06g08014	OsAffx.22569.2.S1_x_at	11/11	6	+	3883193..3884868	oxidoreductase, 2OG-Fe oxygenase family protein
LOC_Os06g08014	OsAffx.22569.2.S1_at	11/11	6	+	3883193..3884868	oxidoreductase, 2OG-Fe oxygenase family protein
LOC_Os06g08014	OsAffx.22569.1.S1_x_at	7/11	6	+	3883193..3884868	oxidoreductase, 2OG-Fe oxygenase family protein
LOC_Os06g08023	Os.27542.1.A1_at	11/11	6	+	3888191..3891360	oxidoreductase, 2OG-Fe oxygenase family protein
LOC_Os06g08023	Os.20904.1.S1_at	8/11	6	+	3888191..3891360	oxidoreductase, 2OG-Fe oxygenase family protein
LOC_Os06g08023	OsAffx.19206.1.S1_x_at	2/11	6	+	3888191..3891360	oxidoreductase, 2OG-Fe oxygenase family protein
LOC_Os06g08032	Os.15663.1.S1_at	5/11	6	+	3892673..3894157	oxidoreductase, 2OG-Fe oxygenase family protein
LOC_Os06g08041	Os.27693.1.S1_at	11/11	6	+	3895491..3897525	iron/ascorbate-dependent oxidoreductase, putative
LOC_Os06g08041	OsAffx.22569.1.S1_x_at	1/11	6	+	3895491..3897525	iron/ascorbate-dependent oxidoreductase, putative
LOC_Os06g08060	Os.54275.1.S1_at	11/11	6	+	3899489..3902057	oxidoreductase, 2OG-Fe oxygenase family protein, expressed

Select all/Clear all

Gene Ontology Classification

GO id	Type	Name
GO:0006412	biological_process	protein biosynthesis
GO:0015935	cellular_component	small ribosomal subunit
GO:0003735	molecular_function	structural constituent of ribosome

Probe Info

Probe Name	Hit(s)	Location	Sequence	TIGR Locus
OsAffx.27499.2.S1_at--64--823	2	Chr06:3874852..3874876 (25 bp)	GGCACAACTTACCACAAAAATCAAG	LOC_Os06g07996
OsAffx.27499.2.S1_at--580--495	2	Chr06:3874828..3874852 (25 bp)	GCATTTGTCAACTACTCTGCATAAG	LOC_Os06g07996
OsAffx.27499.2.S1_at--20--811	2	Chr06:3874680..3874704 (25 bp)	GGACAAGCATTCCAGAAAGGGACTT	LOC_Os06g07996
OsAffx.27499.2.S1_at--1088--287	2	Chr06:3874664..3874688 (25 bp)	AAGGGACTTCAAGAGATGGTGCAAA	LOC_Os06g07996
OsAffx.27499.2.S1_at--711--559	2	Chr06:3874632..3874656 (25 bp)	GAAATACCTCAAATACTTGCGCAGA	LOC_Os06g07996
OsAffx.27499.2.S1_at--133--309	2	Chr06:3874621..3874645 (25 bp)	AATACTTGCGCAGAACCGACTGGGA	LOC_Os06g07996
OsAffx.27499.2.S1_at--1115--543	2	Chr06:3874609..3874633 (25 bp)	GAACCGACTGGGATTCATACTGCCT	LOC_Os06g07996
OsAffx.27499.2.S1_at--489--657	2	Chr06:3874598..3874622 (25 bp)	GATTCATACTGCCTTGTTTTGTCAA	LOC_Os06g07996
OsAffx.27499.2.S1_at--202--257	2	Chr06:3874573..3874597 (25 bp)	AACTGGGACTTCGTGATGTGCCGGA	LOC_Os06g07996
OsAffx.27499.2.S1_at--358--77	2	Chr06:3874558..3874582 (25 bp)	ATGTGCCGGAGTACAAGCCTCCAGA	LOC_Os06g07996
OsAffx.27499.2.S1_at--278--609	2	Chr06:3874550..3874574 (25 bp)	GAGTACAAGCCTCCAGATTACAAGA	LOC_Os06g07996

Target Sequence

GGCACAACTTACCACAAAAATCAAGCATTTGTCAACTACTCTGCATAAGAAGGACAAGCATTCCAGAAAGGGACTTCAAG
AGATGGTGCAAAGGAGGAAGAAATACCTCAAATACTTGCGCAGAACCGACTGGGATTCATACTGCCTTGTTTTGTCAAAA
CTGGGACTTCGTGATGTGCCGGAGTACAAGCCTCCAGATTACAAGA

BLASTn GenBank NR

Expression Profiles

Gene Chronologer
Gene Chronologer (Grouped)
Heterosis View
Gene Correlator (coexpression analysis)
SALK RiceGE
Rice MPSS MPSS logo

RiceArray Coexpression Database

Miscellaneous

SNP data between Minghui 63 and Zhenshan 97 from OryzaSNP project:

Putative homologies in rice

Putative homologies in arabidopsis