OsAffx.26601.1.S1_at |
Description |
tigr:9632.m05296 TID=OsAffx.26601.1 CNT=1 FEA=mRNA TIER=ConsEnd STK=0 NOTE=sequence(s) not in UniGene DEF=Similar to PolI-like DNA polymerase REP_ORG=O. sativa | |||||||||||||||||||||||||||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Associated TIGR Gene Locus |
| |||||||||||||||||||||||||||||||||||||||||||||
Gene Context (flanking 25kb) | ||||||||||||||||||||||||||||||||||||||||||||||
Gene Ontology Classification |
| |||||||||||||||||||||||||||||||||||||||||||||
Probe Info |
| |||||||||||||||||||||||||||||||||||||||||||||
Target Sequence | GTCACATTGAGCGAGCTGCTATCAATGCACCA | |||||||||||||||||||||||||||||||||||||||||||||
Expression Profiles | Gene Chronologer Gene Chronologer (Grouped) Heterosis View Gene Correlator (coexpression analysis) SALK RiceGE Rice MPSS RiceArray Coexpression Database | |||||||||||||||||||||||||||||||||||||||||||||
Miscellaneous | SNP data between Minghui 63 and Zhenshan 97 from OryzaSNP project: Putative homologies in ricePutative homologies in arabidopsis |