Browse Element(s) Details

Os.17160.1.S1_at

Description

gb:BQ907535
DB_XREF= gi:22306313
DB_XREF=P008C09
CLONE=P008C09
TID=Os.17160.1
CNT=3
FEA=EST
TIER=ConsEnd
STK=0
UG=Os.17160 (NCBI UniGene Cluster)
UG_TITLE=Transcribed sequence with weak similarity to protein ref:NP_566649.1 (A.thaliana) expressed protein (Arabidopsis thaliana)
REP_ORG=O. sativa

Associated TIGR Gene Locus

TIGR Locus	Matching Probes	Description
LOC_Os04g01780	11/11	Uncharacterized ACR, COG1399 family protein, expressed

Gene Context (flanking 25kb)

TIGR Locus	Matching Probeset	Matching Probes	Chr	Strand	Coordinates	Description
LOC_Os04g01720	OsAffx.24453.1.S1_at	11/11	4	+	464694..469028	hypothetical protein
LOC_Os04g01720	OsAffx.24453.1.S1_x_at	11/11	4	+	464694..469028	hypothetical protein
LOC_Os04g01720	OsAffx.24453.3.S1_x_at	5/11	4	+	464694..469028	hypothetical protein
LOC_Os04g01720	OsAffx.24453.3.S1_at	1/11	4	+	464694..469028	hypothetical protein
LOC_Os04g01730	OsAffx.31174.4.S1_x_at	7/11	4	+	470063..470881	hypothetical protein
LOC_Os04g01730	OsAffx.31174.5.S1_x_at	5/11	4	+	470063..470881	hypothetical protein
LOC_Os04g01740	Os.11039.1.S1_s_at	11/11	4	+	473779..476549	Heat shock protein 82, putative, expressed
LOC_Os04g01740	OsAffx.13615.1.S1_at	11/11	4	+	473779..476549	Heat shock protein 82, putative, expressed
LOC_Os04g01740	Os.49651.1.S1_s_at	11/11	4	+	473779..476549	Heat shock protein 82, putative, expressed
LOC_Os04g01740	Os.11039.2.S1_x_at	11/11	4	+	473779..476549	Heat shock protein 82, putative, expressed
LOC_Os04g01740	OsAffx.13615.1.S1_x_at	11/11	4	+	473779..476549	Heat shock protein 82, putative, expressed
LOC_Os04g01740	Os.11039.3.S1_at	10/11	4	+	473779..476549	Heat shock protein 82, putative, expressed
LOC_Os04g01750	OsAffx.25823.1.S1_at	9/11	4	+	479673..481633	hypothetical protein
LOC_Os04g01750	OsAffx.29554.1.S1_at	1/11	4	+	479673..481633	hypothetical protein
LOC_Os04g01750	OsAffx.30648.1.S1_at	1/11	4	+	479673..481633	hypothetical protein
LOC_Os04g01760	OsAffx.20736.1.S1_at	2/11	4	+	482972..485921	hypothetical protein
LOC_Os04g01770	OsAffx.10632.1.S1_at	2/11	4	+	486534..488277	retrotransposon protein, putative, Ty3-gypsy subclass
LOC_Os04g01780	Os.17160.1.S1_at	11/11	4	+	489327..491551	Uncharacterized ACR, COG1399 family protein, expressed
LOC_Os04g01780	Os.17160.1.S1_s_at	11/11	4	+	489327..491551	Uncharacterized ACR, COG1399 family protein, expressed
LOC_Os04g01780	OsAffx.13616.1.S1_x_at	11/11	4	+	489327..491551	Uncharacterized ACR, COG1399 family protein, expressed
LOC_Os04g01790	OsAffx.18976.1.S1_at	4/11	4	+	492825..496545	retrotransposon protein, putative, Ty3-gypsy subclass
LOC_Os04g01790	OsAffx.18976.1.S1_x_at	1/11	4	+	492825..496545	retrotransposon protein, putative, Ty3-gypsy subclass
LOC_Os04g01800	OsAffx.3697.1.S1_at	10/11	4	+	506088..506955	hypothetical protein
LOC_Os04g01810	OsAffx.25825.1.S1_at	11/11	4	+	510720..515159	Terpene synthase, N-terminal domain containing protein, expressed
LOC_Os04g01820	Os.10827.1.S1_x_at	10/11	4	+	515910..519698	transposon protein, putative, CACTA, En/Spm sub-class
LOC_Os04g01820	Os.46055.2.S1_x_at	5/11	4	+	515910..519698	transposon protein, putative, CACTA, En/Spm sub-class

Select all/Clear all

Gene Ontology Classification

GO id	Type	Name
NONE	NONE	NONE

Probe Info

Probe Name	Hit(s)	Location	Sequence	TIGR Locus
Os.17160.1.S1_at--579--741	1	Chr04:491482..491506 (25 bp)	GTGTTCGAGGTACCTGAATTCTGAC	LOC_Os04g01780
Os.17160.1.S1_at--954--669	1	Chr04:491484..491508 (25 bp)	GTTCGAGGTACCTGAATTCTGACAT	LOC_Os04g01780
Os.17160.1.S1_at--915--1061	1	Chr04:491485..491509 (25 bp)	TTCGAGGTACCTGAATTCTGACATG	LOC_Os04g01780
Os.17160.1.S1_at--959--615	1	Chr04:491488..491512 (25 bp)	GAGGTACCTGAATTCTGACATGCTA	LOC_Os04g01780
Os.17160.1.S1_at--239--103	1	Chr04:491489..491513 (25 bp)	AGGTACCTGAATTCTGACATGCTAT	LOC_Os04g01780
Os.17160.1.S1_at--980--783	1	Chr04:491490..491514 (25 bp)	GGTACCTGAATTCTGACATGCTATC	LOC_Os04g01780
Os.17160.1.S1_at--1117--697	1	Chr04:491491..491515 (25 bp)	GTACCTGAATTCTGACATGCTATCG	LOC_Os04g01780
Os.17160.1.S1_at--1098--995	1	Chr04:491492..491516 (25 bp)	TACCTGAATTCTGACATGCTATCGG	LOC_Os04g01780
Os.17160.1.S1_at--585--175	1	Chr04:491493..491517 (25 bp)	ACCTGAATTCTGACATGCTATCGGA	LOC_Os04g01780
Os.17160.1.S1_at--640--385	1	Chr04:491495..491519 (25 bp)	CTGAATTCTGACATGCTATCGGAGG	LOC_Os04g01780
Os.17160.1.S1_at--549--521	1	Chr04:491497..491521 (25 bp)	GAATTCTGACATGCTATCGGAGGCA	LOC_Os04g01780

Target Sequence

GTGTTCGAGGTACCTGAATTCTGACATGCTATCGGAGGCA

BLASTn GenBank NR

Expression Profiles

Gene Chronologer
Gene Chronologer (Grouped)
Heterosis View
Gene Correlator (coexpression analysis)
SALK RiceGE
Rice MPSS MPSS logo

RiceArray Coexpression Database

Miscellaneous

SNP data between Minghui 63 and Zhenshan 97 from OryzaSNP project:

Putative homologies in rice

Putative homologies in arabidopsis