Browse Element(s) Details

Os.3740.3.S1_at

Description

gb:AK072444.1
DB_XREF= gi:32982467
TID=Os.3740.3
CNT=5
FEA=FLmRNA
TIER=FL
STK=1
UG=Os.3740 (NCBI UniGene Cluster)
UG_TITLE=(japonica cultivar-group) mRNA for dsRNA-binding protein ODB1, complete cds
DEF=Oryza sativa (japonica cultivar-group) cDNA clone:J023111A18, full insert sequence.
FL= gb:AK072444.1
REP_ORG=O. sativa

Associated TIGR Gene Locus

TIGR Locus	Matching Probes	Description
LOC_Os05g24160	11/11	Double-stranded RNA binding motif family protein, expressed
LOC_Os12g01922	2/11	transducin family protein, putative, expressed

Gene Context (flanking 25kb)

TIGR Locus	Matching Probeset	Matching Probes	Chr	Strand	Coordinates	Description
LOC_Os05g24120	Os.23706.1.A1_x_at	1/11	5	+	13831965..13837549	retrotransposon protein, putative, unclassified
LOC_Os05g24130	OsAffx.14799.1.S1_at	11/11	5	+	13841888..13842130	hypothetical protein
LOC_Os05g24140	OsAffx.14800.1.S1_at	11/11	5	+	13847796..13850669	expressed protein
LOC_Os05g24150	OsAffx.26994.1.S1_at	11/11	5	+	13851093..13854620	pentatricopeptide, putative, expressed
LOC_Os05g24150	OsAffx.11634.2.S1_x_at	1/11	5	+	13851093..13854620	pentatricopeptide, putative, expressed
LOC_Os05g24160	Os.3740.3.S1_at	11/11	5	+	13861625..13868589	Double-stranded RNA binding motif family protein, expressed
LOC_Os05g24160	OsAffx.30773.3.S1_x_at	11/11	5	+	13861625..13868589	Double-stranded RNA binding motif family protein, expressed
LOC_Os05g24160	Os.3740.3.S1_s_at	10/11	5	+	13861625..13868589	Double-stranded RNA binding motif family protein, expressed
LOC_Os05g24160	Os.51834.1.S1_at	5/11	5	+	13861625..13868589	Double-stranded RNA binding motif family protein, expressed
LOC_Os05g24160	OsAffx.30773.1.S1_x_at	5/11	5	+	13861625..13868589	Double-stranded RNA binding motif family protein, expressed
LOC_Os05g24160	OsAffx.30773.2.S1_x_at	4/11	5	+	13861625..13868589	Double-stranded RNA binding motif family protein, expressed
LOC_Os05g24160	OsAffx.32190.1.S1_x_at	2/11	5	+	13861625..13868589	Double-stranded RNA binding motif family protein, expressed
LOC_Os05g24160	OsAffx.32190.1.S1_at	1/11	5	+	13861625..13868589	Double-stranded RNA binding motif family protein, expressed
LOC_Os05g24170	Os.46012.2.S1_x_at	8/11	5	+	13872144..13879440	retrotransposon protein, putative, unclassified
LOC_Os05g24170	Os.46012.3.S1_x_at	6/11	5	+	13872144..13879440	retrotransposon protein, putative, unclassified
LOC_Os05g24170	Os.27088.1.A1_x_at	4/11	5	+	13872144..13879440	retrotransposon protein, putative, unclassified
LOC_Os05g24170	Os.54691.1.S1_x_at	1/11	5	+	13872144..13879440	retrotransposon protein, putative, unclassified
LOC_Os05g24180	OsAffx.26996.1.S1_x_at	11/11	5	+	13886201..13886584	hypothetical protein
LOC_Os05g24180	OsAffx.26996.1.S1_at	11/11	5	+	13886201..13886584	hypothetical protein
LOC_Os05g24190	OsAffx.19542.3.S1_x_at	4/11	5	+	13891540..13895431	retrotransposon protein, putative, Ty1-copia subclass

Select all/Clear all

Gene Ontology Classification

GO id	Type	Name
GO:0009733	biological_process	response to auxin stimulus
GO:0009735	biological_process	response to cytokinin stimulus
GO:0009737	biological_process	response to abscisic acid stimulus
GO:0009793	biological_process	embryonic development (sensu Magnoliophyta)
GO:0035279	biological_process	miRNA-mediated gene silencing, mRNA cleavage
GO:0005634	cellular_component	nucleus
GO:0005737	cellular_component	cytoplasm
GO:0000166	molecular_function	nucleotide binding
GO:0003725	molecular_function	double-stranded RNA binding
GO:0005515	molecular_function	protein binding

Probe Info

Probe Name	Hit(s)	Location	Sequence	TIGR Locus
Os.3740.3.S1_at--809--289	2	Chr11:468219..468243 (25 bp)	AAGGTGAATGTTGCAAAGACACTGC	NONE
Os.3740.3.S1_at--1112--233	2	Chr11:468205..468229 (25 bp)	AAAGACACTGCATAAGCTGCTGCAT	NONE
Os.3740.3.S1_at--731--563	2	Chr11:468202..468226 (25 bp)	GACACTGCATAAGCTGCTGCATTGT	NONE
Os.3740.3.S1_at--216--361	1	Chr05:13861689..13861713 (25 bp)	CATTGTTTATCCTTGTGTGTTTTTG	LOC_Os05g24160
Os.3740.3.S1_at--899--681	1	Chr05:13861685..13861709 (25 bp)	GTTTATCCTTGTGTGTTTTTGACGA	LOC_Os05g24160
Os.3740.3.S1_at--324--1015	1	Chr05:13861682..13861706 (25 bp)	TATCCTTGTGTGTTTTTGACGAAGT	LOC_Os05g24160
Os.3740.3.S1_at--1107--865	3	Chr12:546551..546575 (25 bp)	TGTGTGTTTTTGACGAAGTGCCCTT	LOC_Os12g01922
Os.3740.3.S1_at--700--867	3	Chr12:546549..546573 (25 bp)	TGTGTTTTTGACGAAGTGCCCTTTT	LOC_Os12g01922
Os.3740.3.S1_at--816--1033	1	Chr05:13861651..13861675 (25 bp)	TTTACTTTTTGGTCCAGAGTGATAG	LOC_Os05g24160
Os.3740.3.S1_at--572--367	1	Chr05:13861647..13861671 (25 bp)	CTTTTTGGTCCAGAGTGATAGTACT	LOC_Os05g24160
Os.3740.3.S1_at--535--727	1	Chr05:13861640..13861664 (25 bp)	GTCCAGAGTGATAGTACTAGATAGT	LOC_Os05g24160

Target Sequence

AAGGTGAATGTTGCAAAGACACTGCATAAGCTGCTGCATTGTTTATCCTTGTGTGTTTTTGACGAAGTGCCCTTTTTACT
TTTTGGTCCAGAGTGATAGTACTAGATAGT

BLASTn GenBank NR

Expression Profiles

Gene Chronologer
Gene Chronologer (Grouped)
Heterosis View
Gene Correlator (coexpression analysis)
SALK RiceGE
Rice MPSS MPSS logo

RiceArray Coexpression Database

Miscellaneous

SNP data between Minghui 63 and Zhenshan 97 from OryzaSNP project:

Putative homologies in rice

Putative homologies in arabidopsis