Description |
gb:AK068089.1 DB_XREF=
gi:32978107
TID=Os.52574.2 CNT=1 FEA=FLmRNA TIER=FL STK=1
UG=Os.52574 (NCBI UniGene Cluster) UG_TITLE=(japonica cultivar-group) cDNA
clone:J033025G24, full insert sequence DEF=Oryza sativa (japonica cultivar-group) cDNA
clone:J013132K12, full insert sequence. FL=
gb:AK068089.1 REP_ORG=O. sativa |
Associated TIGR Gene Locus | TIGR Locus | Matching Probes | Description |
---|
LOC_Os04g41450 | 10/11 | POT family protein, expressed | LOC_Os10g31250 | 1/11 | expressed protein | LOC_Os01g16370 | 1/11 | NB-ARC domain containing protein, expressed | LOC_Os01g62440 | 1/11 | RNB-like protein, expressed | LOC_Os02g01720 | 1/11 | expressed protein | LOC_Os03g41438 | 1/11 | Protein Z, putative, expressed | LOC_Os06g03750 | 1/11 | dehydration-responsive family protein, putative, expressed | LOC_Os04g51580 | 1/11 | Leucine Rich Repeat family protein, expressed | LOC_Os03g49464 | 1/11 | pentatricopeptide, putative, expressed | LOC_Os01g38140 | 1/11 | peptidyl-prolyl cis-trans isomerase, FKBP-type family protein, expressed | LOC_Os03g29570 | 1/11 | Mps one binder kinase activator-like 1A, putative, expressed | LOC_Os01g49000 | 1/11 | Katanin p60 ATPase-containing subunit, putative, expressed | LOC_Os12g31230 | 1/11 | transposon protein, putative, CACTA, En/Spm sub-class | LOC_Os04g53110 | 1/11 | hypothetical protein | LOC_Os02g30714 | 1/11 | oxidoreductase, short chain dehydrogenase/reductase family protein, expressed | LOC_Os11g36719 | 1/11 | Lipoxygenase 3, putative, expressed | LOC_Os03g18420 | 1/11 | CHCH domain containing protein, expressed | LOC_Os11g10570 | 1/11 | Leucine Rich Repeat family protein |
|
Gene Context (flanking 25kb) |
|
Gene Ontology Classification | GO id | Type | Name |
---|
GO:0000226 | biological_process | microtubule cytoskeleton organization and biogenesis | GO:0006120 | biological_process | mitochondrial electron transport, NADH to ubiquinone | GO:0006499 | biological_process | N-terminal protein myristoylation | GO:0006857 | biological_process | oligopeptide transport | GO:0006952 | biological_process | defense response | GO:0007165 | biological_process | signal transduction | GO:0009611 | biological_process | response to wounding | GO:0009613 | biological_process | response to pest, pathogen or parasite | GO:0009626 | biological_process | hypersensitive response | GO:0009695 | biological_process | jasmonic acid biosynthesis | GO:0009735 | biological_process | response to cytokinin stimulus | GO:0009737 | biological_process | response to abscisic acid stimulus | GO:0009753 | biological_process | response to jasmonic acid stimulus | GO:0009790 | biological_process | embryonic development | GO:0009816 | biological_process | defense response to pathogenic bacteria, incompatible interaction | GO:0009817 | biological_process | defense response to pathogenic fungi, incompatible interaction | GO:0009825 | biological_process | multidimensional cell growth | GO:0009826 | biological_process | unidimensional cell growth | GO:0009832 | biological_process | cell wall biosynthesis (sensu Magnoliophyta) | GO:0010091 | biological_process | trichome branching (sensu Magnoliophyta) | GO:0019538 | biological_process | protein metabolism | GO:0030154 | biological_process | cell differentiation | GO:0030397 | biological_process | membrane disassembly | GO:0040007 | biological_process | growth | GO:0048364 | biological_process | root development | GO:0005634 | cellular_component | nucleus | GO:0008352 | cellular_component | katanin | GO:0009524 | cellular_component | phragmoplast | GO:0016020 | cellular_component | membrane | GO:0019897 | cellular_component | extrinsic to plasma membrane | GO:0000166 | molecular_function | nucleotide binding | GO:0003723 | molecular_function | RNA binding | GO:0003755 | molecular_function | peptidyl-prolyl cis-trans isomerase activity | GO:0004540 | molecular_function | ribonuclease activity | GO:0004867 | molecular_function | serine-type endopeptidase inhibitor activity | GO:0005215 | molecular_function | transporter activity | GO:0005515 | molecular_function | protein binding | GO:0005516 | molecular_function | calmodulin binding | GO:0005524 | molecular_function | ATP binding | GO:0005528 | molecular_function | FK506 binding | GO:0008137 | molecular_function | NADH dehydrogenase (ubiquinone) activity | GO:0016165 | molecular_function | lipoxygenase activity | GO:0016301 | molecular_function | kinase activity | GO:0016491 | molecular_function | oxidoreductase activity | GO:0016887 | molecular_function | ATPase activity | GO:0030275 | molecular_function | LRR domain binding |
|
Probe Info |
|
Target Sequence | AGAGGTTCATGGCTTCAACACCGTCATATTGCACATAGGCTTGTACACCTGGGCATTCAGTGAAGGCTGTATCCGTGCTT
GCACGCCATCACTTGGAGCGGATCAGTTTGACCATGAAGATCCCTCTGAATCCCGCCAACAATCCAGTTTCTTCAACTGG
TTCACCTTTGGAATCTCCTTAGGAGGATTTATAGGATTGATTCTAATAGTGTGGCTCGAGAACTACAAGGGGTGGGACAT
TGGATTTGGCGTGTGTGCACTGCTAATTCTTCTTGGGTTGCTCATAGTTGCCACTGGCCTCCCTTTCTACCGTAATCAAG
TACCAGAAGGAAGCCCTCTAACTCGGATACTGCAGGTTATAAACTTAAACTAGCATGGTGGCCCGCGCAATCATCATCGT
TATATT BLASTn GenBank NR |
Expression Profiles | Gene Chronologer Gene Chronologer (Grouped) Heterosis View Gene Correlator (coexpression analysis) SALK RiceGE Rice MPSS RiceArray Coexpression Database |
Miscellaneous | SNP data between Minghui 63 and Zhenshan 97 from OryzaSNP project: Putative homologies in ricePutative homologies in arabidopsis |