Browse Element(s) Details

Os.24981.1.A1_at

Description

gb:NM_189869.1
DB_XREF= gi:34906821
GEN=P0594D10.24
TID=Os.24981.1
CNT=1
FEA=mRNA
TIER=ConsEnd
STK=0
UG=Os.24981 (NCBI UniGene Cluster)
UG_TITLE=(japonica cultivar-group) similar to pre-mRNA splicing factor ATP-dependent RNA helicase (P0594D10.24), mRNA
DEF=Oryza sativa (japonica cultivar-group) similar to pre-mRNA splicing factor ATP-dependent RNA helicase (P0594D10.24), mRNA.
REP_ORG=O. sativa

Associated TIGR Gene Locus

TIGR Locus	Matching Probes	Description
LOC_Os07g42900	10/11	Helicase associated domain family protein, expressed
LOC_Os12g04270	1/11	Cytochrome C biogenesis protein transmembrane region containing protein, expressed

Gene Context (flanking 25kb)

TIGR Locus	Matching Probeset	Matching Probes	Chr	Strand	Coordinates	Description
LOC_Os07g42834	Os.7450.1.S1_at	11/11	7	+	25650754..25658431	expressed protein
LOC_Os07g42834	Os.32823.2.S1_s_at	10/11	7	+	25650754..25658431	expressed protein
LOC_Os07g42834	Os.4899.1.S2_at	1/11	7	+	25650754..25658431	expressed protein
LOC_Os07g42850	OsAffx.16688.1.S1_at	10/11	7	+	25659875..25660627	hypothetical protein
LOC_Os07g42860	Os.22837.1.A1_at	11/11	7	+	25661213..25663621	Cyclin, N-terminal domain containing protein, expressed
LOC_Os07g42869	NA	NA	7	+	25669191..25669658	NA
LOC_Os07g42880	Os.42789.1.S1_at	11/11	7	+	25670506..25672380	Rf1 protein, mitochondrial precursor, putative, expressed
LOC_Os07g42890	Os.16990.1.S1_a_at	11/11	7	+	25676187..25678108	GRAM domain-containing protein, putative, expressed
LOC_Os07g42890	Os.18586.1.S1_at	1/11	7	+	25676187..25678108	GRAM domain-containing protein, putative, expressed
LOC_Os07g42900	Os.24981.1.A1_at	10/11	7	+	25681707..25688178	Helicase associated domain family protein, expressed
LOC_Os07g42910	OsAffx.28880.1.S1_s_at	11/11	7	+	25690143..25693050	Cytochrome c oxidase subunit, putative, expressed
LOC_Os07g42910	Os.16582.1.S1_at	11/11	7	+	25690143..25693050	Cytochrome c oxidase subunit, putative, expressed
LOC_Os07g42910	OsAffx.28880.1.S1_at	10/11	7	+	25690143..25693050	Cytochrome c oxidase subunit, putative, expressed
LOC_Os07g42924	OsAffx.5614.1.S1_at	11/11	7	+	25695200..25702385	oxidoreductase, zinc-binding dehydrogenase family protein, expressed
LOC_Os07g42924	OsAffx.5615.1.S1_at	11/11	7	+	25695200..25702385	oxidoreductase, zinc-binding dehydrogenase family protein, expressed
LOC_Os07g42924	Os.34358.1.S1_at	11/11	7	+	25695200..25702385	oxidoreductase, zinc-binding dehydrogenase family protein, expressed
LOC_Os07g42924	Os.11584.2.S1_x_at	1/11	7	+	25695200..25702385	oxidoreductase, zinc-binding dehydrogenase family protein, expressed

Select all/Clear all

Gene Ontology Classification

GO id	Type	Name
GO:0017004	biological_process	cytochrome complex assembly
GO:0005739	cellular_component	mitochondrion
GO:0016020	cellular_component	membrane
GO:0003676	molecular_function	nucleic acid binding
GO:0003723	molecular_function	RNA binding
GO:0003724	molecular_function	RNA helicase activity
GO:0004004	molecular_function	ATP-dependent RNA helicase activity
GO:0004386	molecular_function	helicase activity
GO:0005524	molecular_function	ATP binding

Probe Info

Probe Name	Hit(s)	Location	Sequence	TIGR Locus
Os.24981.1.A1_at--471--587	1	Chr07:25682211..25682235 (25 bp)	GAGCCTCCTTGAGAGCATTTGTTGC	LOC_Os07g42900
Os.24981.1.A1_at--35--245	1	Chr07:25682174..25682198 (25 bp)	AAAATATCGTTTCTGTCCTACTCCT	LOC_Os07g42900
Os.24981.1.A1_at--377--883	1	Chr07:25682150..25682174 (25 bp)	TGATTGCCCATCCATTTACCAAGTG	LOC_Os07g42900
Os.24981.1.A1_at--72--1035	1	Chr07:25682136..25682160 (25 bp)	TTTACCAAGTGGCTGCTGCAGATGC	LOC_Os07g42900
Os.24981.1.A1_at--547--523	1	Chr07:25682050..25682074 (25 bp)	GAATATCATCCTTTCATATCCTGTG	LOC_Os07g42900
Os.24981.1.A1_at--1115--65	1	Chr07:25681995..25682019 (25 bp)	ATGCAACTCTGCTTGAATGGCGCAA	LOC_Os07g42900
Os.24981.1.A1_at--601--289	1	Chr07:25681954..25681978 (25 bp)	AAGGTATGCCCTTCTTGCCACTTTA	LOC_Os07g42900
Os.24981.1.A1_at--731--791	1	Chr07:25681912..25681936 (25 bp)	GGTTGCAACCATGTCGAGTGTAAAT	LOC_Os07g42900
Os.24981.1.A1_at--312--503	2	Chr12:1807335..1807355 (21 bp)	GCAGTCACATTTGTTGGGCATGCTT	LOC_Os12g04270
Os.24981.1.A1_at--1006--659	1	Chr07:25681842..25681861 (20 bp)	GATTGTTATAGCCATCTCAGCCTGC	LOC_Os07g42900
Os.24981.1.A1_at--27--1025	2	Chr07:25680119..25680312 (25 bp)	TTTGGCACCAAAAGGCGGCGGAGCA	NONE

Target Sequence

GAGCCTCCTTGAGAGCATTTGTTGCTTCTAATGCAGGAAAATATCGTTTCTGTCCTACTCCTGATTGCCCATCCATTTAC
CAAGTGGCTGCTGCAGATGCTGAAAGCAAACCTTTTGTCTGTGGGGCTTGCTTTGTGGAGATCTGCAACAAGTGTCATCT
TGAATATCATCCTTTCATATCCTGTGAGGCATACAAAGAATACAAGGAAGACCCTGATGCAACTCTGCTTGAATGGCGCA
AGGGGAAGGAGAATGTGAAGGTATGCCCTTCTTGCCACTTTACAATCGAGAAAGCTGATGGTTGCAACCATGTCGAGTGT
AAATGTGGCAGTCACATTTGTTGGGCATGCTTGGAGAACTTCAGGAGCAGTGATGATTGTTATAGCCATCTCAGCCTGCA
AAGGGGGCAGATCGACCCATTAGGTGCGCTGGCCGACCCTAAAAATTTGGCACCAAAAGGCGGCGGAGCA

BLASTn GenBank NR

Expression Profiles

Gene Chronologer
Gene Chronologer (Grouped)
Heterosis View
Gene Correlator (coexpression analysis)
SALK RiceGE
Rice MPSS MPSS logo

RiceArray Coexpression Database

Miscellaneous

SNP data between Minghui 63 and Zhenshan 97 from OryzaSNP project:

Putative homologies in rice

Putative homologies in arabidopsis