Browse Element(s) Details

OsAffx.32233.1.S1_x_at

Description

gb:X15901.1
DB_XREF= gi:11957
TID=OsAffx.32233.1
CNT=1
FEA=DNA_34
TIER=ConsEnd
STK=0
NOTE=sequence(s) not in UniGene
DEF=unnamed protein product; ORF42; homology to rpl23 (Oryza sativa (japonica cultivar-group)) chloroplast
REP_ORG=O. sativa

Associated TIGR Gene Locus

TIGR Locus	Matching Probes	Description
LOC_Os06g39730	11/11	Ribulose bisphosphate carboxylase large chain, catalytic domain containing protein

Gene Context (flanking 25kb)

TIGR Locus	Matching Probeset	Matching Probes	Chr	Strand	Coordinates	Description
LOC_Os06g39680	Os.50203.1.S1_at	11/11	6	+	23555510..23558218	transposon protein, putative, unclassified, expressed
LOC_Os06g39690	Os.11654.1.S1_at	11/11	6	+	23558711..23562074	SOUL heme-binding protein, expressed
LOC_Os06g39700	Os.26455.2.S1_s_at	11/11	6	+	23565357..23567409	DNA-directed RNA polymerase alpha chain, putative
LOC_Os06g39700	OsAffx.32333.1.S1_x_at	11/11	6	+	23565357..23567409	DNA-directed RNA polymerase alpha chain, putative
LOC_Os06g39700	OsAffx.32331.1.S1_x_at	10/11	6	+	23565357..23567409	DNA-directed RNA polymerase alpha chain, putative
LOC_Os06g39700	OsAffx.32332.1.S1_x_at	7/11	6	+	23565357..23567409	DNA-directed RNA polymerase alpha chain, putative
LOC_Os06g39700	OsAffx.32334.1.S1_x_at	5/11	6	+	23565357..23567409	DNA-directed RNA polymerase alpha chain, putative
LOC_Os06g39710	Os.26592.1.S1_s_at	11/11	6	+	23571438..23572856	Photosystem II P680 chlorophyll A apoprotein, putative
LOC_Os06g39710	Os.26592.3.S1_x_at	7/11	6	+	23571438..23572856	Photosystem II P680 chlorophyll A apoprotein, putative
LOC_Os06g39710	Os.26592.2.A1_s_at	7/11	6	+	23571438..23572856	Photosystem II P680 chlorophyll A apoprotein, putative
LOC_Os06g39710	Os.26592.2.A1_x_at	3/11	6	+	23571438..23572856	Photosystem II P680 chlorophyll A apoprotein, putative
LOC_Os06g39720	OsAffx.32314.1.S1_at	7/11	6	+	23573779..23574126	ATP-dependent Clp protease proteolytic subunit, putative
LOC_Os06g39720	Os.48031.1.S1_x_at	6/11	6	+	23573779..23574126	ATP-dependent Clp protease proteolytic subunit, putative
LOC_Os06g39730	OsAffx.32233.1.S1_x_at	11/11	6	+	23581195..23587647	Ribulose bisphosphate carboxylase large chain, catalytic domain containing protein
LOC_Os06g39730	OsAffx.32259.1.S1_x_at	11/11	6	+	23581195..23587647	Ribulose bisphosphate carboxylase large chain, catalytic domain containing protein
LOC_Os06g39730	OsAffx.26050.2.S2_x_at	11/11	6	+	23581195..23587647	Ribulose bisphosphate carboxylase large chain, catalytic domain containing protein
LOC_Os06g39730	OsAffx.32256.1.S1_x_at	11/11	6	+	23581195..23587647	Ribulose bisphosphate carboxylase large chain, catalytic domain containing protein
LOC_Os06g39730	OsAffx.32255.1.S1_x_at	11/11	6	+	23581195..23587647	Ribulose bisphosphate carboxylase large chain, catalytic domain containing protein
LOC_Os06g39730	Os.26509.1.S1_x_at	11/11	6	+	23581195..23587647	Ribulose bisphosphate carboxylase large chain, catalytic domain containing protein
LOC_Os06g39730	OsAffx.26050.37.S1_s_at	10/11	6	+	23581195..23587647	Ribulose bisphosphate carboxylase large chain, catalytic domain containing protein
LOC_Os06g39730	OsAffx.32258.1.S1_x_at	10/11	6	+	23581195..23587647	Ribulose bisphosphate carboxylase large chain, catalytic domain containing protein
LOC_Os06g39730	Os.26509.1.S1_s_at	10/11	6	+	23581195..23587647	Ribulose bisphosphate carboxylase large chain, catalytic domain containing protein
LOC_Os06g39730	OsAffx.32234.1.S1_x_at	10/11	6	+	23581195..23587647	Ribulose bisphosphate carboxylase large chain, catalytic domain containing protein
LOC_Os06g39730	Os.29056.1.S1_s_at	9/11	6	+	23581195..23587647	Ribulose bisphosphate carboxylase large chain, catalytic domain containing protein
LOC_Os06g39730	OsAffx.32257.1.S1_x_at	8/11	6	+	23581195..23587647	Ribulose bisphosphate carboxylase large chain, catalytic domain containing protein
LOC_Os06g39730	Os.47372.1.S1_x_at	7/11	6	+	23581195..23587647	Ribulose bisphosphate carboxylase large chain, catalytic domain containing protein
LOC_Os06g39730	Os.47372.1.S1_at	7/11	6	+	23581195..23587647	Ribulose bisphosphate carboxylase large chain, catalytic domain containing protein
LOC_Os06g39730	OsAffx.32260.1.S1_at	6/11	6	+	23581195..23587647	Ribulose bisphosphate carboxylase large chain, catalytic domain containing protein
LOC_Os06g39730	OsAffx.32200.1.S1_x_at	2/11	6	+	23581195..23587647	Ribulose bisphosphate carboxylase large chain, catalytic domain containing protein
LOC_Os06g39740	OsAffx.30475.9.S1_s_at	10/11	6	+	23588446..23590352	ATP synthase beta chain, putative
LOC_Os06g39740	OsAffx.30475.5.S1_x_at	9/11	6	+	23588446..23590352	ATP synthase beta chain, putative
LOC_Os06g39740	OsAffx.30475.1.S1_s_at	9/11	6	+	23588446..23590352	ATP synthase beta chain, putative
LOC_Os06g39750	Os.9286.1.S1_at	11/11	6	+	23607741..23610099	Fatty acid elongase, putative, expressed
LOC_Os06g39750	Os.9286.1.S1_s_at	11/11	6	+	23607741..23610099	Fatty acid elongase, putative, expressed
LOC_Os06g39760	Os.15810.2.S1_x_at	11/11	6	+	23612191..23620156	Serine-threonine kinase receptor-associated protein, putative, expressed

Select all/Clear all

Gene Ontology Classification

GO id	Type	Name
GO:0009775	biological_process	photosynthetic electron transport in cytochrome b6/f
GO:0015977	biological_process	carbon utilization by fixation of carbon dioxide
GO:0009507	cellular_component	chloroplast
GO:0009512	cellular_component	cytochrome b6f complex
GO:0016984	molecular_function	ribulose-bisphosphate carboxylase activity
GO:0045158	molecular_function	electron transporter, transferring electrons within cytochrome b6/f complex of photosystem II activity

Probe Info

Probe Name	Hit(s)	Location	Sequence	TIGR Locus
OsAffx.32233.1.S1_x_at--736--815	15	Chr11:18901360..18901384 (25 bp)	GGAAAGAATCAATGACATACAATGC	NONE
OsAffx.32233.1.S1_x_at--710--67	5	Chr11:18901371..18901390 (20 bp)	ATGACATACAATGCATTACAGACGT	NONE
OsAffx.32233.1.S1_x_at--460--567	14	Chr10:10531596..10531620 (25 bp)	GACATACAATGCATTACAGACGTAT	NONE
OsAffx.32233.1.S1_x_at--134--985	14	Chr10:10473648..10473672 (25 bp)	TACAATGCATTACAGACGTATGATC	NONE
OsAffx.32233.1.S1_x_at--954--319	14	Chr12:20909009..20909028 (20 bp)	CAATGCATTACAGACGTATGATCAT	NONE
OsAffx.32233.1.S1_x_at--993--63	14	Chr12:20909009..20909030 (22 bp)	ATGCATTACAGACGTATGATCATTA	NONE
OsAffx.32233.1.S1_x_at--690--493	14	Chr12:20909009..20909032 (24 bp)	GCATTACAGACGTATGATCATTACC	NONE
OsAffx.32233.1.S1_x_at--1035--11	14	Chr12:20909010..20909034 (25 bp)	ATTACAGACGTATGATCATTACCCT	NONE
OsAffx.32233.1.S1_x_at--521--1043	14	Chr12:20909011..20909035 (25 bp)	TTACAGACGTATGATCATTACCCTT	NONE
OsAffx.32233.1.S1_x_at--939--985	14	Chr12:20909012..20909036 (25 bp)	TACAGACGTATGATCATTACCCTTT	NONE
OsAffx.32233.1.S1_x_at--359--213	4	Chr12:20909013..20909037 (25 bp)	ACAGACGTATGATCATTACCCTTTA	NONE

Target Sequence

GGAAAGAATCAATGACATACAATGCATTACAGACGTATGATCATTACCCTTTA

BLASTn GenBank NR

Expression Profiles

Gene Chronologer
Gene Chronologer (Grouped)
Heterosis View
Gene Correlator (coexpression analysis)
SALK RiceGE
Rice MPSS MPSS logo

RiceArray Coexpression Database

Miscellaneous

SNP data between Minghui 63 and Zhenshan 97 from OryzaSNP project:

Putative homologies in rice

Putative homologies in arabidopsis