Description |
gb:X15901.1 DB_XREF=
gi:11957 GEN=infA
TID=OsAffx.32334.1 CNT=1 FEA=DNA_62 TIER=ConsEnd STK=0 NOTE=sequence(s) not in UniGene DEF=initiation factor 1 (Oryza sativa (japonica cultivar-group)) chloroplast PROD=initiation factor 1 REP_ORG=O. sativa |
Associated TIGR Gene Locus | TIGR Locus | Matching Probes | Description |
---|
LOC_Os01g57944 | 11/11 | DNA-directed RNA polymerase alpha chain, putative, expressed | LOC_Os12g33960 | 7/11 | translation initiation factor IF-1 family protein | LOC_Os01g49614 | 6/11 | Protein kinase domain containing protein, expressed | LOC_Os05g22710 | 5/11 | DNA-directed RNA polymerase alpha chain, putative | LOC_Os06g39700 | 5/11 | DNA-directed RNA polymerase alpha chain, putative | LOC_Os04g16790 | 5/11 | DNA-directed RNA polymerase alpha chain, putative, expressed | LOC_Os10g21330 | 5/11 | DNA-directed RNA polymerase alpha chain, putative, expressed | LOC_Os08g15250 | 5/11 | DNA-directed RNA polymerase alpha chain, putative | LOC_Os06g28750 | 4/11 | retrotransposon protein, putative, Ty1-copia subclass |
|
Gene Context (flanking 25kb) |
|
Gene Ontology Classification | GO id | Type | Name |
---|
GO:0006071 | biological_process | glycerol metabolism | GO:0006412 | biological_process | protein biosynthesis | GO:0009621 | biological_process | response to pathogenic fungi | GO:0000312 | cellular_component | plastid small ribosomal subunit | GO:0003723 | molecular_function | RNA binding | GO:0003735 | molecular_function | structural constituent of ribosome | GO:0004675 | molecular_function | transmembrane receptor protein serine/threonine kinase activity | GO:0008889 | molecular_function | glycerophosphodiester phosphodiesterase activity | GO:0016301 | molecular_function | kinase activity |
|
Probe Info |
|
Target Sequence | GAGAAGCAAAAATTACTTTCGAGGGTTTAGTTATGGAAGCCCTACCCAACGGAATGTTCCGCGTTCGCCTAGAGAATGAC
ACCATCATCCTGGGCTATATTTCAGGAAAGATCCGGTCTAGTTCTATACGAATACTGATGGGGGATAGGGTCAAAATTGA
AGTAAGTCGTTATGATTCAAGCAAGGGGCGTATAATTTATAGACTTCCCCATAAGGATTCGAAGCGTACCGAAGACTCGA
AGGATACCGAAGAT BLASTn GenBank NR |
Expression Profiles | Gene Chronologer Gene Chronologer (Grouped) Heterosis View Gene Correlator (coexpression analysis) SALK RiceGE Rice MPSS RiceArray Coexpression Database |
Miscellaneous | SNP data between Minghui 63 and Zhenshan 97 from OryzaSNP project: Putative homologies in ricePutative homologies in arabidopsis |