Browse Element(s) Details

OsAffx.5033.1.S1_at

Description

tigr:9634.m03513
TID=OsAffx.5033.1
CNT=1
FEA=mRNA
TIER=ConsEnd
STK=0
NOTE=sequence(s) not in UniGene
DEF=Similar to probable cytochrome P450 T19L18.2 (similarity) - Arabidopsis thaliana
REP_ORG=O. sativa

Associated TIGR Gene Locus

TIGR Locus	Matching Probes	Description
LOC_Os06g36920	11/11	thromboxane-A synthase, putative, expressed

Gene Context (flanking 25kb)

TIGR Locus	Matching Probeset	Matching Probes	Chr	Strand	Coordinates	Description
LOC_Os06g36880	Os.53027.1.S1_at	11/11	6	+	21729405..21732640	Cysteine synthase, putative, expressed
LOC_Os06g36890	Os.49494.1.S1_at	1/11	6	+	21734128..21738841	Glycosyl transferase, putative
LOC_Os06g36900	OsAffx.31869.1.S1_at	11/11	6	+	21740287..21741402	retrotransposon protein, putative, unclassified
LOC_Os06g36900	OsAffx.31869.5.S1_x_at	4/11	6	+	21740287..21741402	retrotransposon protein, putative, unclassified
LOC_Os06g36900	OsAffx.31869.3.S1_s_at	3/11	6	+	21740287..21741402	retrotransposon protein, putative, unclassified
LOC_Os06g36900	OsAffx.31869.4.S1_x_at	1/11	6	+	21740287..21741402	retrotransposon protein, putative, unclassified
LOC_Os06g36910	OsAffx.15786.1.S1_at	11/11	6	+	21749359..21751422	Rf1 protein, mitochondrial precursor, putative
LOC_Os06g36920	OsAffx.5033.1.S1_at	11/11	6	+	21754621..21757567	thromboxane-A synthase, putative, expressed
LOC_Os06g36920	OsAffx.5032.1.S1_at	7/11	6	+	21754621..21757567	thromboxane-A synthase, putative, expressed
LOC_Os06g36930	OsAffx.27969.1.S1_x_at	11/11	6	+	21760307..21761424	HSF-type DNA-binding domain containing protein
LOC_Os06g36940	OsAffx.15787.3.S1_at	10/11	6	+	21762419..21764047	expressed protein
LOC_Os06g36950	Os.20602.2.S1_x_at	11/11	6	+	21764817..21767012	hAT family dimerisation domain containing protein
LOC_Os06g36960	OsAffx.29755.2.S1_x_at	11/11	6	+	21771555..21778666	hypothetical protein
LOC_Os06g36960	OsAffx.29755.2.S1_at	11/11	6	+	21771555..21778666	hypothetical protein
LOC_Os06g36960	OsAffx.29755.4.S1_x_at	9/11	6	+	21771555..21778666	hypothetical protein
LOC_Os06g36960	OsAffx.29755.5.S1_x_at	9/11	6	+	21771555..21778666	hypothetical protein
LOC_Os06g36960	OsAffx.29755.1.S1_s_at	6/11	6	+	21771555..21778666	hypothetical protein
LOC_Os06g36960	OsAffx.29755.3.S1_x_at	4/11	6	+	21771555..21778666	hypothetical protein
LOC_Os06g36970	OsAffx.30941.2.S1_x_at	9/11	6	+	21779781..21783748	transposon protein, putative, unclassified
LOC_Os06g36970	OsAffx.30941.9.S1_x_at	8/11	6	+	21779781..21783748	transposon protein, putative, unclassified
LOC_Os06g36970	OsAffx.30941.5.S1_x_at	7/11	6	+	21779781..21783748	transposon protein, putative, unclassified
LOC_Os06g36970	OsAffx.30941.1.S1_x_at	4/11	6	+	21779781..21783748	transposon protein, putative, unclassified

Select all/Clear all

Gene Ontology Classification

GO id	Type	Name
GO:0009699	biological_process	phenylpropanoid biosynthesis
GO:0009809	biological_process	lignin biosynthesis
GO:0009934	biological_process	regulation of meristem organization
GO:0010223	biological_process	secondary shoot formation
GO:0016117	biological_process	carotenoid biosynthesis
GO:0005792	cellular_component	microsome
GO:0004497	molecular_function	monooxygenase activity
GO:0019825	molecular_function	oxygen binding
GO:0046409	molecular_function	p-coumarate 3-hydroxylase activity

Probe Info

Probe Name	Hit(s)	Location	Sequence	TIGR Locus
OsAffx.5033.1.S1_at--636--383	1	Chr06:21757512..21757536 (25 bp)	CTGCGAGGGATCAGCCATGGCTGCT	LOC_Os06g36920
OsAffx.5033.1.S1_at--379--383	1	Chr06:21757492..21757516 (25 bp)	CTGCTGCTGCCGTGGTCCTGGCTCG	LOC_Os06g36920
OsAffx.5033.1.S1_at--95--751	1	Chr06:21757453..21757477 (25 bp)	GTGGTCGTCTACTTCTACGCGCCGT	LOC_Os06g36920
OsAffx.5033.1.S1_at--347--401	1	Chr06:21757448..21757472 (25 bp)	CGTCTACTTCTACGCGCCGTGGTGG	LOC_Os06g36920
OsAffx.5033.1.S1_at--432--161	1	Chr06:21757118..21757142 (25 bp)	AGCTGTGCAAGGAGGTCGGGATCAG	LOC_Os06g36920
OsAffx.5033.1.S1_at--601--943	1	Chr06:21757103..21757127 (25 bp)	TCGGGATCAGGCAGTTTAAGAGCAT	LOC_Os06g36920
OsAffx.5033.1.S1_at--62--645	1	Chr06:21757099..21757123 (25 bp)	GATCAGGCAGTTTAAGAGCATCGCA	LOC_Os06g36920
OsAffx.5033.1.S1_at--955--963	1	Chr06:21757097..21757121 (25 bp)	TCAGGCAGTTTAAGAGCATCGCAAA	LOC_Os06g36920
OsAffx.5033.1.S1_at--458--679	1	Chr06:21757090..21757114 (25 bp)	GTTTAAGAGCATCGCAAACCGGAGC	LOC_Os06g36920
OsAffx.5033.1.S1_at--271--979	1	Chr06:21757087..21757111 (25 bp)	TAAGAGCATCGCAAACCGGAGCTTG	LOC_Os06g36920
OsAffx.5033.1.S1_at--178--593	1	Chr06:21757084..21757108 (25 bp)	GAGCATCGCAAACCGGAGCTTGCCG	LOC_Os06g36920

Target Sequence

CTGCGAGGGATCAGCCATGGCTGCTGCTGCCGTGGTCCTGGCTCGCCGGCGTCGTGGTGGTGGTCGTCTACTTCTACGCG
CCGTGGTGGGGCGTCCGGCGGGTGCCGGGGCCGGCCGCCCTCCCCGTCGTCGGCCACCTGCCGCTGCTCGCCGCCCATGG
CCCCGACGTGTTCGCCGTCCTCGCCAAGAAATACGGGCCCATCTTCAGGTTTCATTTGGGGAGGCAGCCGCTGGTGATTG
TGGCGGAGGCGGAGCTGTGCAAGGAGGTCGGGATCAGGCAGTTTAAGAGCATCGCAAACCGGAGCTTGCCG

BLASTn GenBank NR

Expression Profiles

Gene Chronologer
Gene Chronologer (Grouped)
Heterosis View
Gene Correlator (coexpression analysis)
SALK RiceGE
Rice MPSS MPSS logo

RiceArray Coexpression Database

Miscellaneous

SNP data between Minghui 63 and Zhenshan 97 from OryzaSNP project:

Putative homologies in rice

Putative homologies in arabidopsis