Browse Element(s) Details

OsAffx.6436.1.S1_at

Description

tigr:9637.m02589
TID=OsAffx.6436.1
CNT=1
FEA=mRNA
TIER=ConsEnd
STK=0
NOTE=sequence(s) not in UniGene
DEF=hypothetical protein
REP_ORG=O. sativa

Associated TIGR Gene Locus

TIGR Locus	Matching Probes	Description
LOC_Os09g29239	11/11	purine permease, putative, expressed

Gene Context (flanking 25kb)

TIGR Locus	Matching Probeset	Matching Probes	Chr	Strand	Coordinates	Description
LOC_Os09g29160	Os.54056.1.S1_at	11/11	9	+	17730573..17732251	expressed protein
LOC_Os09g29170	Os.18351.2.S1_at	11/11	9	+	17733588..17737427	Protein kinase domain containing protein, expressed
LOC_Os09g29170	Os.18351.1.S1_at	11/11	9	+	17733588..17737427	Protein kinase domain containing protein, expressed
LOC_Os09g29170	Os.18351.2.S1_x_at	9/11	9	+	17733588..17737427	Protein kinase domain containing protein, expressed
LOC_Os09g29180	Os.41695.2.S1_x_at	7/11	9	+	17739943..17741068	hypothetical protein
LOC_Os09g29180	Os.41695.3.S1_x_at	7/11	9	+	17739943..17741068	hypothetical protein
LOC_Os09g29180	Os.41695.5.S1_x_at	3/11	9	+	17739943..17741068	hypothetical protein
LOC_Os09g29180	Os.41695.4.S1_x_at	1/11	9	+	17739943..17741068	hypothetical protein
LOC_Os09g29190	Os.9119.1.S1_at	11/11	9	+	17741621..17745504	Phosphoribosylaminoimidazole-succinocarboxamide synthase, chloroplast precursor, putative, expressed
LOC_Os09g29200	Os.11962.1.S1_at	11/11	9	+	17746186..17747739	Glutathione S-transferase, N-terminal domain containing protein, expressed
LOC_Os09g29200	Os.39243.1.A1_x_at	2/11	9	+	17746186..17747739	Glutathione S-transferase, N-terminal domain containing protein, expressed
LOC_Os09g29210	Os.11962.2.A1_at	11/11	9	+	17747183..17750262	purine permease, putative, expressed
LOC_Os09g29210	OsAffx.30073.1.S1_at	10/11	9	+	17747183..17750262	purine permease, putative, expressed
LOC_Os09g29210	Os.11962.3.S1_x_at	9/11	9	+	17747183..17750262	purine permease, putative, expressed
LOC_Os09g29239	Os.18356.2.S1_at	11/11	9	+	17754699..17770402	purine permease, putative, expressed
LOC_Os09g29239	OsAffx.6436.1.S1_at	11/11	9	+	17754699..17770402	purine permease, putative, expressed
LOC_Os09g29239	Os.18356.1.S1_x_at	11/11	9	+	17754699..17770402	purine permease, putative, expressed
LOC_Os09g29239	OsAffx.1746.1.S1_at	2/11	9	+	17754699..17770402	purine permease, putative, expressed
LOC_Os09g29239	Os.32889.2.S1_at	1/11	9	+	17754699..17770402	purine permease, putative, expressed
LOC_Os09g29239	Os.10219.1.S1_at	1/11	9	+	17754699..17770402	purine permease, putative, expressed
LOC_Os09g29270	Os.51207.1.S1_s_at	11/11	9	+	17772463..17773353	expressed protein
LOC_Os09g29284	Os.54337.1.S1_at	11/11	9	+	17776150..17783626	MATE efflux family protein, expressed
LOC_Os09g29284	OsAffx.6437.1.S1_at	11/11	9	+	17776150..17783626	MATE efflux family protein, expressed
LOC_Os09g29300	OsAffx.6438.1.S1_at	11/11	9	+	17784709..17785710	expressed protein
LOC_Os09g29310	OsAffx.6439.1.S1_x_at	10/11	9	+	17787246..17790986	Zinc finger, C3HC4 type family protein, expressed
LOC_Os09g29310	OsAffx.6439.1.S1_at	10/11	9	+	17787246..17790986	Zinc finger, C3HC4 type family protein, expressed

Select all/Clear all

Gene Ontology Classification

GO id	Type	Name
GO:0006863	biological_process	purine transport
GO:0010184	biological_process	cytokinin transport
GO:0005887	cellular_component	integral to plasma membrane
GO:0005345	molecular_function	purine transporter activity
GO:0015211	molecular_function	purine nucleoside transporter activity

Probe Info

Probe Name	Hit(s)	Location	Sequence	TIGR Locus
OsAffx.6436.1.S1_at--355--855	1	Chr09:17767410..17767434 (25 bp)	TGGAGGTGCTTGAGCGCATGGCCAA	LOC_Os09g29239
OsAffx.6436.1.S1_at--744--291	1	Chr09:17767387..17767411 (25 bp)	AAGGAGTTGCAAAGCCAGGTTGCCG	LOC_Os09g29239
OsAffx.6436.1.S1_at--1001--121	1	Chr09:17767383..17767407 (25 bp)	AGTTGCAAAGCCAGGTTGCCGCTGA	LOC_Os09g29239
OsAffx.6436.1.S1_at--678--1073	1	Chr09:17767381..17767405 (25 bp)	TTGCAAAGCCAGGTTGCCGCTGAGG	LOC_Os09g29239
OsAffx.6436.1.S1_at--254--511	1	Chr09:17767379..17767403 (25 bp)	GCAAAGCCAGGTTGCCGCTGAGGCC	LOC_Os09g29239
OsAffx.6436.1.S1_at--931--887	1	Chr09:17767361..17767385 (25 bp)	TGAGGCCCCCGATGAATCCAAGGAG	LOC_Os09g29239
OsAffx.6436.1.S1_at--925--165	1	Chr09:17767332..17767356 (25 bp)	AGCGCGAGCGCGTCCACCATGAACT	LOC_Os09g29239
OsAffx.6436.1.S1_at--582--435	1	Chr09:17767319..17767343 (25 bp)	CCACCATGAACTCCAAAAGCTTTGT	LOC_Os09g29239
OsAffx.6436.1.S1_at--452--545	1	Chr09:17767312..17767336 (25 bp)	GAACTCCAAAAGCTTTGTCGGCCTA	LOC_Os09g29239
OsAffx.6436.1.S1_at--142--1	1	Chr09:17767308..17767332 (25 bp)	TCCAAAAGCTTTGTCGGCCTACGTC	LOC_Os09g29239
OsAffx.6436.1.S1_at--986--327	1	Chr09:17767306..17767330 (25 bp)	CAAAAGCTTTGTCGGCCTACGTCCG	LOC_Os09g29239

Target Sequence

TGGAGGTGCTTGAGCGCATGGCCAAGGAGTTGCAAAGCCAGGTTGCCGCTGAGGCCCCCGATGAATCCAAGGAGGAGAAG
CGCGAGCGCGTCCACCATGAACTCCAAAAGCTTTGTCGGCCTACGTCCG

BLASTn GenBank NR

Expression Profiles

Gene Chronologer
Gene Chronologer (Grouped)
Heterosis View
Gene Correlator (coexpression analysis)
SALK RiceGE
Rice MPSS MPSS logo

RiceArray Coexpression Database

Miscellaneous

SNP data between Minghui 63 and Zhenshan 97 from OryzaSNP project:

Putative homologies in rice

Putative homologies in arabidopsis